Incidental Mutation 'R1502:Etnppl'
ID169338
Institutional Source Beutler Lab
Gene Symbol Etnppl
Ensembl Gene ENSMUSG00000019232
Gene Nameethanolamine phosphate phospholyase
Synonyms1300019H02Rik, Agxt2l1
MMRRC Submission 039552-MU
Accession Numbers

Genbank: NM_027907.3, NM_001163587.1; Ensembl: ENSMUST00000072271

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1502 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location130617448-130637521 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130628789 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 222 (I222V)
Ref Sequence ENSEMBL: ENSMUSP00000131294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072271] [ENSMUST00000163620] [ENSMUST00000166187]
Predicted Effect probably benign
Transcript: ENSMUST00000072271
AA Change: I222V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072121
Gene: ENSMUSG00000019232
AA Change: I222V

DomainStartEndE-ValueType
Pfam:Aminotran_3 32 373 2.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163620
AA Change: I216V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129120
Gene: ENSMUSG00000019232
AA Change: I216V

DomainStartEndE-ValueType
Pfam:Aminotran_3 32 367 1.6e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166187
AA Change: I222V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131294
Gene: ENSMUSG00000019232
AA Change: I222V

DomainStartEndE-ValueType
Pfam:Aminotran_3 26 433 1.3e-91 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170664
AA Change: I27V
SMART Domains Protein: ENSMUSP00000128425
Gene: ENSMUSG00000019232
AA Change: I27V

DomainStartEndE-ValueType
Pfam:Aminotran_3 2 120 4.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T G 11: 109,974,645 T329P probably damaging Het
Adamts4 C A 1: 171,258,990 P784T probably damaging Het
Adamts6 T C 13: 104,493,637 L1096P probably damaging Het
Ap1b1 A G 11: 5,040,290 S849G probably benign Het
Arap2 T C 5: 62,604,404 S1660G probably benign Het
Atp10b A C 11: 43,230,347 T946P probably damaging Het
Brpf1 A G 6: 113,322,420 D1103G probably damaging Het
Bub1 A G 2: 127,827,419 Y102H probably damaging Het
C87499 T A 4: 88,628,032 I358F probably benign Het
Ccdc182 A G 11: 88,294,367 E91G probably benign Het
Cd200r4 C T 16: 44,833,440 T154M probably damaging Het
Cdh20 A G 1: 104,954,030 T407A probably benign Het
Col6a2 T C 10: 76,614,678 I140V probably benign Het
Csn3 C A 5: 87,930,124 T163K probably damaging Het
Dars2 A T 1: 161,046,805 L438* probably null Het
Dbr1 T C 9: 99,582,387 L289P probably damaging Het
Ddx46 A G 13: 55,663,309 R573G possibly damaging Het
Defb10 T C 8: 21,858,956 I10T possibly damaging Het
Dis3l T C 9: 64,325,787 E136G possibly damaging Het
Dnajb13 T C 7: 100,507,461 Q136R probably benign Het
Dse A T 10: 34,153,218 S625R probably damaging Het
Dvl3 A G 16: 20,523,459 D94G probably damaging Het
E130311K13Rik A C 3: 63,915,547 Y225* probably null Het
Evc2 T C 5: 37,393,096 L818P probably benign Het
Fbn1 A T 2: 125,363,706 C1083* probably null Het
Flnc G A 6: 29,438,694 V196I probably benign Het
Fscn3 A G 6: 28,435,623 D415G probably benign Het
Gm3448 A G 17: 14,967,614 F133L probably benign Het
Gm4861 A C 3: 137,550,620 V75G probably damaging Het
Gpld1 A T 13: 24,971,416 T345S probably benign Het
Grik4 T C 9: 42,520,873 S943G probably damaging Het
Grik4 C T 9: 42,591,447 R460Q probably benign Het
Ifi207 A C 1: 173,729,306 L629R possibly damaging Het
Ift52 G A 2: 163,029,862 probably null Het
Insl3 A G 8: 71,690,232 D79G probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Lag3 T C 6: 124,909,243 Y249C probably damaging Het
Lipe T C 7: 25,398,147 N124D possibly damaging Het
Lnpep A G 17: 17,571,644 Y412H probably damaging Het
Lrtm2 A G 6: 119,317,274 Y299H probably benign Het
Lypd4 T C 7: 24,866,828 T24A probably benign Het
Magi1 T A 6: 93,694,170 I805F probably damaging Het
Mfap3 T C 11: 57,528,149 L45P probably benign Het
Nbea G A 3: 56,004,889 P1159L probably benign Het
Ndst4 A T 3: 125,437,758 probably benign Het
Notch1 A T 2: 26,484,323 N229K possibly damaging Het
Nova1 A G 12: 46,720,832 I102T unknown Het
Npepps T C 11: 97,218,575 E725G possibly damaging Het
Olfr1157 T C 2: 87,962,035 N286D probably damaging Het
Olfr211 T C 6: 116,494,281 I224T probably damaging Het
Olfr743 A T 14: 50,533,777 M122L possibly damaging Het
Olfr822 T C 10: 130,074,872 I154T probably damaging Het
Pappa2 A T 1: 158,957,288 W51R probably damaging Het
Pde8a T C 7: 81,292,259 S149P probably damaging Het
Phkb T A 8: 86,059,339 L1052Q possibly damaging Het
Pou5f2 T A 13: 78,025,251 L104Q probably benign Het
Psme2b A T 11: 48,945,749 W124R probably damaging Het
Ptk2b G A 14: 66,163,080 S762L possibly damaging Het
Ptprs T C 17: 56,437,992 N248S probably benign Het
Rgs22 G A 15: 36,080,851 T705I probably damaging Het
Rnf123 T C 9: 108,068,510 probably null Het
Sel1l2 A T 2: 140,389,595 I13N probably damaging Het
Slc39a4 T C 15: 76,616,593 T57A probably benign Het
Smpdl3a T G 10: 57,809,091 V319G probably damaging Het
Syt9 T C 7: 107,436,487 L237P probably damaging Het
Tbc1d16 G T 11: 119,154,004 A536E probably damaging Het
Tcf20 T C 15: 82,855,576 D558G probably damaging Het
Tdpoz2 A T 3: 93,652,146 M173K probably benign Het
Tek A G 4: 94,781,102 I113M probably damaging Het
Tmem50a A T 4: 134,909,669 D50E probably benign Het
Tmem8 A G 17: 26,120,316 T535A possibly damaging Het
Trappc11 A T 8: 47,530,827 V10E possibly damaging Het
Vmn1r172 C T 7: 23,660,256 R189* probably null Het
Vmn2r63 A T 7: 42,928,591 D174E possibly damaging Het
Zc3h10 A T 10: 128,544,282 M402K probably damaging Het
Zfp109 T C 7: 24,228,163 H615R probably damaging Het
Zfp982 A C 4: 147,512,669 H161P probably benign Het
Zhx1 A G 15: 58,054,596 F85L probably damaging Het
Other mutations in Etnppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Etnppl APN 3 130631778 missense possibly damaging 0.81
IGL02087:Etnppl APN 3 130626545 missense probably benign
IGL02524:Etnppl APN 3 130630671 unclassified probably benign
IGL03101:Etnppl APN 3 130622318 missense probably damaging 1.00
IGL03120:Etnppl APN 3 130620692 missense probably damaging 1.00
1mM(1):Etnppl UTSW 3 130628830 splice site probably benign
PIT4810001:Etnppl UTSW 3 130620714 missense probably benign 0.35
R0279:Etnppl UTSW 3 130629413 missense probably damaging 1.00
R1075:Etnppl UTSW 3 130629563 missense probably benign 0.01
R1117:Etnppl UTSW 3 130634563 missense probably benign 0.00
R1581:Etnppl UTSW 3 130628744 missense possibly damaging 0.80
R1730:Etnppl UTSW 3 130620749 missense probably damaging 1.00
R1783:Etnppl UTSW 3 130620749 missense probably damaging 1.00
R1816:Etnppl UTSW 3 130634562 missense probably benign
R1855:Etnppl UTSW 3 130620722 missense probably benign 0.40
R1885:Etnppl UTSW 3 130629462 missense probably benign 0.04
R2330:Etnppl UTSW 3 130630575 missense probably damaging 1.00
R4067:Etnppl UTSW 3 130631793 missense probably damaging 1.00
R5862:Etnppl UTSW 3 130631824 missense possibly damaging 0.89
R6183:Etnppl UTSW 3 130620317 missense probably damaging 1.00
R6374:Etnppl UTSW 3 130620693 missense probably damaging 1.00
R7169:Etnppl UTSW 3 130620696 missense probably damaging 1.00
R7324:Etnppl UTSW 3 130629575 missense probably damaging 1.00
R7654:Etnppl UTSW 3 130629511 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTGTGTTTCTAGCCATTTCAAACC -3'
(R):5'- AGAGTCCCGAAGTAGCATGTAGTCAG -3'

Sequencing Primer
(F):5'- attcatgccttctgacctcc -3'
(R):5'- GTCAGGAGCAGATTTTTACCAGC -3'
Posted On2014-04-13