Incidental Mutation 'R1502:Magi1'
ID169351
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 1
SynonymsAIP3, Baiap1, BAP1, Gukmi1, WWP3
MMRRC Submission 039552-MU
Accession Numbers

NCBI RefSeq: NM_010367.2; NM_001083320.1 NM_001029850.3, NM_001083321.1; MGI: 1203522

Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R1502 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location93675455-94283917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93694170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 805 (I805F)
Ref Sequence ENSEMBL: ENSMUSP00000145515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
Predicted Effect probably benign
Transcript: ENSMUST00000055224
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089317
AA Change: I1021F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095
AA Change: I1021F

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000093769
AA Change: I805F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095
AA Change: I805F

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203519
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203688
AA Change: I805F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095
AA Change: I805F

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204347
AA Change: I1033F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095
AA Change: I1033F

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204532
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T G 11: 109,974,645 T329P probably damaging Het
Adamts4 C A 1: 171,258,990 P784T probably damaging Het
Adamts6 T C 13: 104,493,637 L1096P probably damaging Het
Ap1b1 A G 11: 5,040,290 S849G probably benign Het
Arap2 T C 5: 62,604,404 S1660G probably benign Het
Atp10b A C 11: 43,230,347 T946P probably damaging Het
Brpf1 A G 6: 113,322,420 D1103G probably damaging Het
Bub1 A G 2: 127,827,419 Y102H probably damaging Het
C87499 T A 4: 88,628,032 I358F probably benign Het
Ccdc182 A G 11: 88,294,367 E91G probably benign Het
Cd200r4 C T 16: 44,833,440 T154M probably damaging Het
Cdh20 A G 1: 104,954,030 T407A probably benign Het
Col6a2 T C 10: 76,614,678 I140V probably benign Het
Csn3 C A 5: 87,930,124 T163K probably damaging Het
Dars2 A T 1: 161,046,805 L438* probably null Het
Dbr1 T C 9: 99,582,387 L289P probably damaging Het
Ddx46 A G 13: 55,663,309 R573G possibly damaging Het
Defb10 T C 8: 21,858,956 I10T possibly damaging Het
Dis3l T C 9: 64,325,787 E136G possibly damaging Het
Dnajb13 T C 7: 100,507,461 Q136R probably benign Het
Dse A T 10: 34,153,218 S625R probably damaging Het
Dvl3 A G 16: 20,523,459 D94G probably damaging Het
E130311K13Rik A C 3: 63,915,547 Y225* probably null Het
Etnppl A G 3: 130,628,789 I222V probably benign Het
Evc2 T C 5: 37,393,096 L818P probably benign Het
Fbn1 A T 2: 125,363,706 C1083* probably null Het
Flnc G A 6: 29,438,694 V196I probably benign Het
Fscn3 A G 6: 28,435,623 D415G probably benign Het
Gm3448 A G 17: 14,967,614 F133L probably benign Het
Gm4861 A C 3: 137,550,620 V75G probably damaging Het
Gpld1 A T 13: 24,971,416 T345S probably benign Het
Grik4 T C 9: 42,520,873 S943G probably damaging Het
Grik4 C T 9: 42,591,447 R460Q probably benign Het
Ifi207 A C 1: 173,729,306 L629R possibly damaging Het
Ift52 G A 2: 163,029,862 probably null Het
Insl3 A G 8: 71,690,232 D79G probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Lag3 T C 6: 124,909,243 Y249C probably damaging Het
Lipe T C 7: 25,398,147 N124D possibly damaging Het
Lnpep A G 17: 17,571,644 Y412H probably damaging Het
Lrtm2 A G 6: 119,317,274 Y299H probably benign Het
Lypd4 T C 7: 24,866,828 T24A probably benign Het
Mfap3 T C 11: 57,528,149 L45P probably benign Het
Nbea G A 3: 56,004,889 P1159L probably benign Het
Ndst4 A T 3: 125,437,758 probably benign Het
Notch1 A T 2: 26,484,323 N229K possibly damaging Het
Nova1 A G 12: 46,720,832 I102T unknown Het
Npepps T C 11: 97,218,575 E725G possibly damaging Het
Olfr1157 T C 2: 87,962,035 N286D probably damaging Het
Olfr211 T C 6: 116,494,281 I224T probably damaging Het
Olfr743 A T 14: 50,533,777 M122L possibly damaging Het
Olfr822 T C 10: 130,074,872 I154T probably damaging Het
Pappa2 A T 1: 158,957,288 W51R probably damaging Het
Pde8a T C 7: 81,292,259 S149P probably damaging Het
Phkb T A 8: 86,059,339 L1052Q possibly damaging Het
Pou5f2 T A 13: 78,025,251 L104Q probably benign Het
Psme2b A T 11: 48,945,749 W124R probably damaging Het
Ptk2b G A 14: 66,163,080 S762L possibly damaging Het
Ptprs T C 17: 56,437,992 N248S probably benign Het
Rgs22 G A 15: 36,080,851 T705I probably damaging Het
Rnf123 T C 9: 108,068,510 probably null Het
Sel1l2 A T 2: 140,389,595 I13N probably damaging Het
Slc39a4 T C 15: 76,616,593 T57A probably benign Het
Smpdl3a T G 10: 57,809,091 V319G probably damaging Het
Syt9 T C 7: 107,436,487 L237P probably damaging Het
Tbc1d16 G T 11: 119,154,004 A536E probably damaging Het
Tcf20 T C 15: 82,855,576 D558G probably damaging Het
Tdpoz2 A T 3: 93,652,146 M173K probably benign Het
Tek A G 4: 94,781,102 I113M probably damaging Het
Tmem50a A T 4: 134,909,669 D50E probably benign Het
Tmem8 A G 17: 26,120,316 T535A possibly damaging Het
Trappc11 A T 8: 47,530,827 V10E possibly damaging Het
Vmn1r172 C T 7: 23,660,256 R189* probably null Het
Vmn2r63 A T 7: 42,928,591 D174E possibly damaging Het
Zc3h10 A T 10: 128,544,282 M402K probably damaging Het
Zfp109 T C 7: 24,228,163 H615R probably damaging Het
Zfp982 A C 4: 147,512,669 H161P probably benign Het
Zhx1 A G 15: 58,054,596 F85L probably damaging Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94283093 missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93747224 missense probably damaging 0.99
IGL01642:Magi1 APN 6 93686624 missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93792400 unclassified probably null
IGL01967:Magi1 APN 6 93708134 missense probably damaging 1.00
IGL01984:Magi1 APN 6 93708174 missense probably damaging 1.00
IGL02074:Magi1 APN 6 93745598 missense probably damaging 1.00
IGL02098:Magi1 APN 6 93678787 missense probably damaging 1.00
IGL02225:Magi1 APN 6 93694026 missense probably damaging 1.00
IGL02522:Magi1 APN 6 93678636 missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93785610 missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93686873 missense probably damaging 1.00
P0007:Magi1 UTSW 6 93745988 missense probably damaging 1.00
R0149:Magi1 UTSW 6 93747245 missense probably damaging 1.00
R0512:Magi1 UTSW 6 93694064 missense probably damaging 1.00
R1487:Magi1 UTSW 6 93708079 missense probably benign 0.00
R1497:Magi1 UTSW 6 93747329 missense probably damaging 1.00
R1824:Magi1 UTSW 6 93699639 missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93755045 missense probably benign
R2132:Magi1 UTSW 6 93697274 missense probably damaging 0.99
R2331:Magi1 UTSW 6 93685562 missense probably damaging 1.00
R2418:Magi1 UTSW 6 93745910 missense probably damaging 1.00
R3076:Magi1 UTSW 6 93757687 missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93699629 missense probably damaging 0.98
R4005:Magi1 UTSW 6 93701318 missense probably damaging 1.00
R4455:Magi1 UTSW 6 93785457 missense probably damaging 1.00
R4670:Magi1 UTSW 6 93686643 splice site probably null
R4671:Magi1 UTSW 6 93680787 critical splice donor site probably null
R4839:Magi1 UTSW 6 93694196 missense probably damaging 1.00
R5132:Magi1 UTSW 6 93683091 critical splice acceptor site probably null
R5147:Magi1 UTSW 6 93747267 missense probably damaging 1.00
R5525:Magi1 UTSW 6 93792373 missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93680871 missense probably benign 0.03
R5724:Magi1 UTSW 6 93745701 missense probably damaging 1.00
R5846:Magi1 UTSW 6 93685603 missense probably damaging 1.00
R5896:Magi1 UTSW 6 93708199 missense probably damaging 1.00
R5912:Magi1 UTSW 6 93708145 missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93745590 missense probably damaging 1.00
R6115:Magi1 UTSW 6 93708070 missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93943229 missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94283196 missense probably benign 0.06
R6457:Magi1 UTSW 6 93699639 missense probably damaging 1.00
R6464:Magi1 UTSW 6 93699789 missense probably damaging 1.00
R6613:Magi1 UTSW 6 93745673 missense probably damaging 1.00
R6661:Magi1 UTSW 6 93943308 missense probably benign 0.08
R6755:Magi1 UTSW 6 93708177 missense probably damaging 1.00
R6909:Magi1 UTSW 6 93697320 missense probably damaging 1.00
R7180:Magi1 UTSW 6 93815750 missense probably benign 0.10
R7224:Magi1 UTSW 6 93683089 missense probably benign 0.34
R7447:Magi1 UTSW 6 93745581 missense possibly damaging 0.63
R7517:Magi1 UTSW 6 93708208 missense probably damaging 0.99
R7537:Magi1 UTSW 6 93708110 nonsense probably null
R7549:Magi1 UTSW 6 93708114 missense probably benign 0.19
R7566:Magi1 UTSW 6 93678327 missense probably benign 0.03
R7805:Magi1 UTSW 6 93682946 missense probably benign
R8022:Magi1 UTSW 6 93697365 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGGAGAGTCACTGTGTTGC -3'
(R):5'- AGAGAAGCTGGGGTTTTGCCATC -3'

Sequencing Primer
(F):5'- CCCGCTTCTTTGATTAGGTTG -3'
(R):5'- CCTTCACTATATTCCCACATAAC -3'
Posted On2014-04-13