Mutagenetix > Incidental Mutations

Incidental Mutation 'R1502:Gpld1'

169390

Institutional Source

Beutler Lab

Gene Symbol

Gpld1

Ensembl Gene

ENSMUSG00000021340

Gene Name

glycosylphosphatidylinositol specific phospholipase D1

Synonyms

6330541J12Rik

MMRRC Submission

039552-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1502 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24943152-24992501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24971416 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 345 (T345S)

Ref Sequence

ENSEMBL: ENSMUSP00000021773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021773]

Predicted Effect

probably benign
Transcript: ENSMUST00000021773
AA Change: T345S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: T345S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Zn_dep_PLPC	28	219	9.8e-28	PFAM
Int_alpha	377	435	7.21e-11	SMART
Int_alpha	446	503	7.43e-13	SMART
Int_alpha	509	565	7.86e-3	SMART
Int_alpha	576	643	4.09e0	SMART
Blast:Int_alpha	644	708	2e-24	BLAST
Int_alpha	716	774	1.86e-4	SMART
Blast:Int_alpha	789	837	1e-16	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223873

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	G	11: 109,974,645	T329P	probably damaging	Het
Adamts4	C	A	1: 171,258,990	P784T	probably damaging	Het
Adamts6	T	C	13: 104,493,637	L1096P	probably damaging	Het
Ap1b1	A	G	11: 5,040,290	S849G	probably benign	Het
Arap2	T	C	5: 62,604,404	S1660G	probably benign	Het
Atp10b	A	C	11: 43,230,347	T946P	probably damaging	Het
Brpf1	A	G	6: 113,322,420	D1103G	probably damaging	Het
Bub1	A	G	2: 127,827,419	Y102H	probably damaging	Het
C87499	T	A	4: 88,628,032	I358F	probably benign	Het
Ccdc182	A	G	11: 88,294,367	E91G	probably benign	Het
Cd200r4	C	T	16: 44,833,440	T154M	probably damaging	Het
Cdh20	A	G	1: 104,954,030	T407A	probably benign	Het
Col6a2	T	C	10: 76,614,678	I140V	probably benign	Het
Csn3	C	A	5: 87,930,124	T163K	probably damaging	Het
Dars2	A	T	1: 161,046,805	L438*	probably null	Het
Dbr1	T	C	9: 99,582,387	L289P	probably damaging	Het
Ddx46	A	G	13: 55,663,309	R573G	possibly damaging	Het
Defb10	T	C	8: 21,858,956	I10T	possibly damaging	Het
Dis3l	T	C	9: 64,325,787	E136G	possibly damaging	Het
Dnajb13	T	C	7: 100,507,461	Q136R	probably benign	Het
Dse	A	T	10: 34,153,218	S625R	probably damaging	Het
Dvl3	A	G	16: 20,523,459	D94G	probably damaging	Het
E130311K13Rik	A	C	3: 63,915,547	Y225*	probably null	Het
Etnppl	A	G	3: 130,628,789	I222V	probably benign	Het
Evc2	T	C	5: 37,393,096	L818P	probably benign	Het
Fbn1	A	T	2: 125,363,706	C1083*	probably null	Het
Flnc	G	A	6: 29,438,694	V196I	probably benign	Het
Fscn3	A	G	6: 28,435,623	D415G	probably benign	Het
Gm3448	A	G	17: 14,967,614	F133L	probably benign	Het
Gm4861	A	C	3: 137,550,620	V75G	probably damaging	Het
Grik4	T	C	9: 42,520,873	S943G	probably damaging	Het
Grik4	C	T	9: 42,591,447	R460Q	probably benign	Het
Ifi207	A	C	1: 173,729,306	L629R	possibly damaging	Het
Ift52	G	A	2: 163,029,862		probably null	Het
Insl3	A	G	8: 71,690,232	D79G	probably damaging	Het
Kif5a	A	T	10: 127,245,441	I208N	probably damaging	Het
Lag3	T	C	6: 124,909,243	Y249C	probably damaging	Het
Lipe	T	C	7: 25,398,147	N124D	possibly damaging	Het
Lnpep	A	G	17: 17,571,644	Y412H	probably damaging	Het
Lrtm2	A	G	6: 119,317,274	Y299H	probably benign	Het
Lypd4	T	C	7: 24,866,828	T24A	probably benign	Het
Magi1	T	A	6: 93,694,170	I805F	probably damaging	Het
Mfap3	T	C	11: 57,528,149	L45P	probably benign	Het
Nbea	G	A	3: 56,004,889	P1159L	probably benign	Het
Ndst4	A	T	3: 125,437,758		probably benign	Het
Notch1	A	T	2: 26,484,323	N229K	possibly damaging	Het
Nova1	A	G	12: 46,720,832	I102T	unknown	Het
Npepps	T	C	11: 97,218,575	E725G	possibly damaging	Het
Olfr1157	T	C	2: 87,962,035	N286D	probably damaging	Het
Olfr211	T	C	6: 116,494,281	I224T	probably damaging	Het
Olfr743	A	T	14: 50,533,777	M122L	possibly damaging	Het
Olfr822	T	C	10: 130,074,872	I154T	probably damaging	Het
Pappa2	A	T	1: 158,957,288	W51R	probably damaging	Het
Pde8a	T	C	7: 81,292,259	S149P	probably damaging	Het
Phkb	T	A	8: 86,059,339	L1052Q	possibly damaging	Het
Pou5f2	T	A	13: 78,025,251	L104Q	probably benign	Het
Psme2b	A	T	11: 48,945,749	W124R	probably damaging	Het
Ptk2b	G	A	14: 66,163,080	S762L	possibly damaging	Het
Ptprs	T	C	17: 56,437,992	N248S	probably benign	Het
Rgs22	G	A	15: 36,080,851	T705I	probably damaging	Het
Rnf123	T	C	9: 108,068,510		probably null	Het
Sel1l2	A	T	2: 140,389,595	I13N	probably damaging	Het
Slc39a4	T	C	15: 76,616,593	T57A	probably benign	Het
Smpdl3a	T	G	10: 57,809,091	V319G	probably damaging	Het
Syt9	T	C	7: 107,436,487	L237P	probably damaging	Het
Tbc1d16	G	T	11: 119,154,004	A536E	probably damaging	Het
Tcf20	T	C	15: 82,855,576	D558G	probably damaging	Het
Tdpoz2	A	T	3: 93,652,146	M173K	probably benign	Het
Tek	A	G	4: 94,781,102	I113M	probably damaging	Het
Tmem50a	A	T	4: 134,909,669	D50E	probably benign	Het
Tmem8	A	G	17: 26,120,316	T535A	possibly damaging	Het
Trappc11	A	T	8: 47,530,827	V10E	possibly damaging	Het
Vmn1r172	C	T	7: 23,660,256	R189*	probably null	Het
Vmn2r63	A	T	7: 42,928,591	D174E	possibly damaging	Het
Zc3h10	A	T	10: 128,544,282	M402K	probably damaging	Het
Zfp109	T	C	7: 24,228,163	H615R	probably damaging	Het
Zfp982	A	C	4: 147,512,669	H161P	probably benign	Het
Zhx1	A	G	15: 58,054,596	F85L	probably damaging	Het

Other mutations in Gpld1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Gpld1	APN	13	24986922	splice site	probably benign
IGL00886:Gpld1	APN	13	24962353	nonsense	probably null
IGL01060:Gpld1	APN	13	24982566	missense	probably damaging	1.00
IGL01450:Gpld1	APN	13	24979681	missense	probably damaging	1.00
IGL02176:Gpld1	APN	13	24984209	critical splice donor site	probably null
IGL02288:Gpld1	APN	13	24979683	nonsense	probably null
IGL02323:Gpld1	APN	13	24982774	missense	probably damaging	0.97
IGL02588:Gpld1	APN	13	24943699	missense	probably damaging	1.00
IGL02832:Gpld1	APN	13	24952878	missense	probably damaging	1.00
IGL02989:Gpld1	APN	13	24990036	missense	possibly damaging	0.87
IGL03282:Gpld1	APN	13	24971408	missense	probably benign	0.01
IGL03345:Gpld1	APN	13	24987024	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0308:Gpld1	UTSW	13	24962835	missense	possibly damaging	0.81
R0441:Gpld1	UTSW	13	24962320	nonsense	probably null
R1172:Gpld1	UTSW	13	24957566	splice site	probably null
R1411:Gpld1	UTSW	13	24962808	missense	probably damaging	0.99
R1565:Gpld1	UTSW	13	24956068	missense	probably damaging	0.99
R1931:Gpld1	UTSW	13	24943710	missense	possibly damaging	0.71
R1999:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2150:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2240:Gpld1	UTSW	13	24982507	critical splice acceptor site	probably null
R2327:Gpld1	UTSW	13	24984821	missense	probably benign	0.00
R2373:Gpld1	UTSW	13	24962856	missense	probably benign	0.26
R3153:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24956163	critical splice donor site	probably null
R3911:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R4616:Gpld1	UTSW	13	24984816	missense	probably damaging	1.00
R4660:Gpld1	UTSW	13	24982603	unclassified	probably null
R4755:Gpld1	UTSW	13	24979688	missense	probably benign	0.13
R4755:Gpld1	UTSW	13	24979692	nonsense	probably null
R4835:Gpld1	UTSW	13	24982716	missense	probably benign	0.00
R4895:Gpld1	UTSW	13	24979728	missense	probably damaging	0.97
R5050:Gpld1	UTSW	13	24962756	missense	probably benign	0.00
R5182:Gpld1	UTSW	13	24984070	unclassified	probably null
R6161:Gpld1	UTSW	13	24971414	missense	probably benign	0.00
R6626:Gpld1	UTSW	13	24979970	missense	probably damaging	1.00
R7021:Gpld1	UTSW	13	24984708	missense	probably damaging	1.00
R7577:Gpld1	UTSW	13	24962405	missense	probably benign	0.05
R7583:Gpld1	UTSW	13	24975760	missense	probably damaging	1.00
R7659:Gpld1	UTSW	13	24979981	missense	probably benign	0.00
R7737:Gpld1	UTSW	13	24975726	missense	probably damaging	1.00
R7738:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R7752:Gpld1	UTSW	13	24962775	missense	probably damaging	1.00
R7759:Gpld1	UTSW	13	24962400	missense	probably damaging	0.99
X0024:Gpld1	UTSW	13	24982596	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAAATCAATGCAGAGGCGGGC -3'
(R):5'- CCCAAAGCTGACAAAGGGCTGAATG -3'

Sequencing Primer
(F):5'- GCTTTGAGGAAATCCTAGCTGAC -3'
(R):5'- GGGAGTCAACATTCCCAGTCTAAG -3'

Posted On

2014-04-13