Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Cdan1'

169424

Institutional Source

Beutler Lab

Gene Symbol

Cdan1

Ensembl Gene

ENSMUSG00000027284

Gene Name

congenital dyserythropoietic anemia, type I (human)

Synonyms

codanin-1, CDA-I, CDA1, 1500015A01Rik

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120716154-120850128 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120729575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 369 (H369Q)

Ref Sequence

ENSEMBL: ENSMUSP00000106329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000110700] [ENSMUST00000110701] [ENSMUST00000154193]

AlphaFold

Q8CC12

Predicted Effect

probably benign
Transcript: ENSMUST00000028740

SMART Domains

Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100

Domain	Start	End	E-Value	Type
Pfam:Pkinase	90	347	7e-31	PFAM
Pfam:Pkinase_Tyr	90	348	8.2e-19	PFAM
low complexity region	369	383	N/A	INTRINSIC
low complexity region	1143	1156	N/A	INTRINSIC
low complexity region	1205	1242	N/A	INTRINSIC
low complexity region	1254	1271	N/A	INTRINSIC
low complexity region	1285	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000057135

SMART Domains

Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100

Domain	Start	End	E-Value	Type
Pfam:Pkinase	21	274	1.2e-32	PFAM
Pfam:Pkinase_Tyr	21	280	3.8e-19	PFAM
low complexity region	300	314	N/A	INTRINSIC
low complexity region	1074	1087	N/A	INTRINSIC
low complexity region	1136	1173	N/A	INTRINSIC
low complexity region	1185	1202	N/A	INTRINSIC
low complexity region	1216	1240	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085840

SMART Domains

Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100

Domain	Start	End	E-Value	Type
Pfam:Pkinase	21	274	1.2e-32	PFAM
Pfam:Pkinase_Tyr	21	280	3.8e-19	PFAM
low complexity region	300	314	N/A	INTRINSIC
low complexity region	1074	1087	N/A	INTRINSIC
low complexity region	1136	1173	N/A	INTRINSIC
low complexity region	1185	1202	N/A	INTRINSIC
low complexity region	1216	1240	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110700
AA Change: H369Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106328
Gene: ENSMUSG00000027284
AA Change: H369Q

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
low complexity region	78	99	N/A	INTRINSIC
low complexity region	102	151	N/A	INTRINSIC
low complexity region	154	180	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	786	906	2.4e-48	PFAM
low complexity region	1157	1171	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110701
AA Change: H369Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106329
Gene: ENSMUSG00000027284
AA Change: H369Q

Domain	Start	End	E-Value	Type
low complexity region	77	98	N/A	INTRINSIC
low complexity region	101	150	N/A	INTRINSIC
low complexity region	153	179	N/A	INTRINSIC
low complexity region	326	337	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC
low complexity region	724	735	N/A	INTRINSIC
Pfam:Codanin-1_C	789	904	2.4e-41	PFAM
low complexity region	1164	1178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129384

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136725

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150860

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152692

Predicted Effect

probably benign
Transcript: ENSMUST00000154193

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to play a role in nuclear envelope integrity, possibly related to microtubule attachments. Mutations in this gene cause congenital dyserythropoietic anemia type I, a disease resulting in morphological and functional abnormalities of erythropoiesis. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality between implantation and somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Cdan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Cdan1	APN	2	120725985	missense	probably damaging	1.00
IGL01660:Cdan1	APN	2	120725653	missense	possibly damaging	0.63
IGL01930:Cdan1	APN	2	120726582	intron	probably benign
IGL02597:Cdan1	APN	2	120725239	missense	probably benign	0.08
IGL03025:Cdan1	APN	2	120730741	missense	probably damaging	1.00
IGL03130:Cdan1	APN	2	120727912	missense	possibly damaging	0.94
IGL03388:Cdan1	APN	2	120730511	utr 3 prime	probably benign
FR4737:Cdan1	UTSW	2	120724971	missense	probably damaging	0.96
R0001:Cdan1	UTSW	2	120723751	missense	probably benign	0.41
R0650:Cdan1	UTSW	2	120726045	missense	probably benign	0.00
R0781:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R0881:Cdan1	UTSW	2	120720985	missense	probably damaging	1.00
R1110:Cdan1	UTSW	2	120720602	missense	probably damaging	1.00
R1345:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1370:Cdan1	UTSW	2	120719139	critical splice donor site	probably null
R1579:Cdan1	UTSW	2	120730739	missense	probably damaging	0.98
R1664:Cdan1	UTSW	2	120720506	missense	probably damaging	0.99
R1749:Cdan1	UTSW	2	120729799	missense	probably damaging	0.96
R1765:Cdan1	UTSW	2	120720749	missense	probably damaging	1.00
R1806:Cdan1	UTSW	2	120731426	utr 3 prime	probably benign
R1856:Cdan1	UTSW	2	120724936	missense	probably benign
R2202:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2203:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R2204:Cdan1	UTSW	2	120720760	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120725632	missense	probably damaging	1.00
R3957:Cdan1	UTSW	2	120731020	utr 3 prime	probably benign
R4060:Cdan1	UTSW	2	120725743	missense	probably benign	0.00
R4324:Cdan1	UTSW	2	120724979	missense	probably damaging	0.97
R4379:Cdan1	UTSW	2	120726618	missense	probably damaging	1.00
R4611:Cdan1	UTSW	2	120730720	missense	probably damaging	0.96
R4695:Cdan1	UTSW	2	120728383	missense	probably damaging	1.00
R4866:Cdan1	UTSW	2	120731447	utr 3 prime	probably benign
R5183:Cdan1	UTSW	2	120729580	missense	probably damaging	0.96
R5347:Cdan1	UTSW	2	120730065	missense	possibly damaging	0.95
R5789:Cdan1	UTSW	2	120729535	missense	probably benign	0.22
R5958:Cdan1	UTSW	2	120723902	missense	possibly damaging	0.80
R6608:Cdan1	UTSW	2	120726680	missense	possibly damaging	0.78
R7055:Cdan1	UTSW	2	120727861	missense	probably damaging	0.97
R7065:Cdan1	UTSW	2	120718921	missense	probably benign	0.00
R7225:Cdan1	UTSW	2	120724912	missense	probably benign
R7238:Cdan1	UTSW	2	120730302	missense	probably benign
R7316:Cdan1	UTSW	2	120728332	critical splice donor site	probably null
R7325:Cdan1	UTSW	2	120724704	missense	probably benign	0.25
R7432:Cdan1	UTSW	2	120722755	missense	probably damaging	1.00
R7517:Cdan1	UTSW	2	120727924	missense	probably damaging	1.00
R7691:Cdan1	UTSW	2	120729567	missense	probably damaging	1.00
R8004:Cdan1	UTSW	2	120731443	missense	unknown
R8324:Cdan1	UTSW	2	120727325	missense	probably benign	0.07
R8465:Cdan1	UTSW	2	120728440	missense	possibly damaging	0.93
R8556:Cdan1	UTSW	2	120722990	missense	probably damaging	1.00
R8932:Cdan1	UTSW	2	120731087	nonsense	probably null
R9462:Cdan1	UTSW	2	120729579	missense	possibly damaging	0.87
R9718:Cdan1	UTSW	2	120724169	missense	probably damaging	1.00
X0050:Cdan1	UTSW	2	120724145	missense	probably benign	0.29
Z1088:Cdan1	UTSW	2	120730336	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGCAATCCTTGCTTAGCACCAAAC -3'
(R):5'- CAGCTCCTTACTGCTCGGAGAATG -3'

Sequencing Primer
(F):5'- accaaacaaaacaaaacaaaaaaacc -3'
(R):5'- GCTCGGAGAATGGTGGC -3'

Posted On

2014-04-13