Incidental Mutation 'R1503:Bpifb2'
ID 169426
Institutional Source Beutler Lab
Gene Symbol Bpifb2
Ensembl Gene ENSMUSG00000027481
Gene Name BPI fold containing family B, member 2
Synonyms 2310069A01Rik, Bpil1, 2310034L21Rik
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R1503 (G1)
Quality Score 106
Status Not validated
Chromosome 2
Chromosomal Location 153875045-153895270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 153889510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 269 (D269N)
Ref Sequence ENSEMBL: ENSMUSP00000028983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028983]
AlphaFold Q8C1E1
Predicted Effect possibly damaging
Transcript: ENSMUST00000028983
AA Change: D269N

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028983
Gene: ENSMUSG00000027481
AA Change: D269N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 36 194 2.4e-27 PFAM
BPI2 253 456 2.67e-26 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipid transfer/lipopolysaccharide binding protein (LT/LBP) gene family. It is highly expressed in hypertrophic tonsils. This gene and three other members of the LT/LBP gene family form a cluster on the long arm of chromosome 20. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atf7ip G T 6: 136,606,867 V1299L probably damaging Het
Atp12a A T 14: 56,373,424 N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 G439D probably damaging Het
Btd T G 14: 31,667,655 C444W probably damaging Het
Cacna1a A G 8: 84,601,946 D1624G probably benign Het
Carmil3 A C 14: 55,498,280 N563T probably damaging Het
Cars T C 7: 143,568,989 R538G probably benign Het
Catsperd A G 17: 56,654,525 K416E possibly damaging Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccpg1 A G 9: 72,999,478 N66S probably benign Het
Cd48 T A 1: 171,695,847 L86H probably damaging Het
Cdan1 A T 2: 120,729,575 H369Q probably damaging Het
Chil4 T C 3: 106,206,034 D189G probably benign Het
Cit T A 5: 115,873,900 Y189N possibly damaging Het
Cntn3 G A 6: 102,464,565 Q7* probably null Het
Csn1s2a A T 5: 87,775,799 I5F possibly damaging Het
Ctnnd1 C T 2: 84,605,179 probably null Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Dnah12 T C 14: 26,773,692 S1426P probably damaging Het
Dnhd1 T G 7: 105,693,660 S1404A possibly damaging Het
Drosha T A 15: 12,848,073 C484S probably benign Het
Dsg4 A T 18: 20,449,679 I125F probably damaging Het
Egfr T A 11: 16,869,301 M277K possibly damaging Het
Eml5 G T 12: 98,831,174 L1059I probably damaging Het
Erbb4 G T 1: 68,346,546 H295N probably benign Het
Etl4 T G 2: 20,743,874 V139G possibly damaging Het
Fam160a1 T A 3: 85,672,477 Y807F possibly damaging Het
Frem3 A T 8: 80,687,018 E1969D probably damaging Het
Gdf3 T A 6: 122,606,337 D357V probably damaging Het
Gimap8 T A 6: 48,647,529 probably null Het
Gml2 C A 15: 74,821,352 S68* probably null Het
Gphn A G 12: 78,504,629 I248V possibly damaging Het
Greb1 A T 12: 16,724,819 Y192* probably null Het
Hmbs A C 9: 44,337,432 L215W probably benign Het
Iglon5 T A 7: 43,479,025 T123S probably benign Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Ints8 A T 4: 11,245,842 L212Q probably damaging Het
Itgad A G 7: 128,198,121 Y846C probably benign Het
Kcnj1 A G 9: 32,396,492 T51A probably damaging Het
Kif1bp A G 10: 62,559,408 V485A probably damaging Het
Kif9 A T 9: 110,510,438 K449N possibly damaging Het
Klk11 G A 7: 43,778,909 W241* probably null Het
Krt32 T C 11: 100,084,110 probably null Het
Loxl1 A G 9: 58,293,640 F513S probably damaging Het
Mapk8ip3 A T 17: 24,904,923 S571T probably damaging Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mtss1 T C 15: 58,951,672 N282S probably damaging Het
Myh13 T A 11: 67,353,674 D1012E probably benign Het
Myo16 A G 8: 10,502,817 T952A probably benign Het
Neb T C 2: 52,298,620 D874G probably damaging Het
Nek11 A G 9: 105,163,204 Y553H probably damaging Het
Nr2c2 T A 6: 92,105,331 V9D probably benign Het
Nxf1 T A 19: 8,762,436 F51L probably benign Het
Olfr1260 T C 2: 89,978,528 V250A probably damaging Het
Olfr1347 T C 7: 6,488,179 I232V probably damaging Het
Olfr1350 A G 7: 6,570,471 N160S probably damaging Het
Olfr170 A G 16: 19,606,312 S119P probably benign Het
Olfr344 A T 2: 36,568,873 I92F probably damaging Het
Olfr397 T G 11: 73,964,568 probably null Het
Olfr750 A G 14: 51,070,734 S220P probably damaging Het
Pcdhb8 A T 18: 37,356,519 N76Y probably damaging Het
Pdzrn4 T A 15: 92,399,804 F217I probably damaging Het
Ppp1r16a T A 15: 76,694,399 H434Q probably benign Het
Prpf19 T A 19: 10,901,022 F291I possibly damaging Het
R3hdm2 G T 10: 127,471,826 E319* probably null Het
Sel1l3 A G 5: 53,137,929 Y777H probably damaging Het
Serpinb5 G A 1: 106,870,289 A3T possibly damaging Het
Skp2 C A 15: 9,127,911 V88F probably damaging Het
Slc25a16 T C 10: 62,928,376 Y71H probably damaging Het
Slc6a6 T A 6: 91,740,992 I304N probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox17 C A 1: 4,491,928 G222C probably damaging Het
Trmu T A 15: 85,895,019 V289E possibly damaging Het
Vdac2 A G 14: 21,837,877 E96G probably damaging Het
Wdhd1 A T 14: 47,247,400 D885E probably benign Het
Zfp646 A G 7: 127,880,136 N495S probably damaging Het
Zfp663 T C 2: 165,352,653 T549A probably damaging Het
Zfp935 G A 13: 62,455,137 A83V possibly damaging Het
Other mutations in Bpifb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Bpifb2 APN 2 153891275 splice site probably benign
IGL02164:Bpifb2 APN 2 153883562 missense probably damaging 0.99
IGL03063:Bpifb2 APN 2 153889124 missense probably damaging 1.00
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0044:Bpifb2 UTSW 2 153882679 splice site probably benign
R0084:Bpifb2 UTSW 2 153891091 missense probably benign 0.03
R0791:Bpifb2 UTSW 2 153878519 missense probably benign 0.05
R2278:Bpifb2 UTSW 2 153878479 nonsense probably null
R3810:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R3812:Bpifb2 UTSW 2 153891951 missense probably benign 0.04
R4030:Bpifb2 UTSW 2 153891317 missense probably benign 0.30
R4573:Bpifb2 UTSW 2 153889492 missense probably damaging 0.99
R4713:Bpifb2 UTSW 2 153881193 missense probably damaging 0.98
R5143:Bpifb2 UTSW 2 153878504 missense probably damaging 1.00
R5523:Bpifb2 UTSW 2 153875985 unclassified probably benign
R5899:Bpifb2 UTSW 2 153891130 missense probably damaging 1.00
R6011:Bpifb2 UTSW 2 153889576 splice site probably null
R6172:Bpifb2 UTSW 2 153890412 missense probably benign 0.15
R6378:Bpifb2 UTSW 2 153891152 missense possibly damaging 0.93
R6878:Bpifb2 UTSW 2 153875912 unclassified probably benign
R7381:Bpifb2 UTSW 2 153892348 missense probably benign 0.01
R7390:Bpifb2 UTSW 2 153889806 missense possibly damaging 0.89
R7424:Bpifb2 UTSW 2 153890540 missense possibly damaging 0.93
R7473:Bpifb2 UTSW 2 153881196 missense possibly damaging 0.80
R7493:Bpifb2 UTSW 2 153889477 missense possibly damaging 0.74
R8145:Bpifb2 UTSW 2 153891312 missense probably damaging 1.00
R8178:Bpifb2 UTSW 2 153891956 missense probably damaging 0.99
R8725:Bpifb2 UTSW 2 153889436 missense possibly damaging 0.47
R8960:Bpifb2 UTSW 2 153889126 missense possibly damaging 0.90
R9201:Bpifb2 UTSW 2 153891983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTTACAGGCCCTTGGTTCCTGATG -3'
(R):5'- GCTCTGGCCTACAAAGAGCAGAAAC -3'

Sequencing Primer
(F):5'- TTGGTTCCTGATGTCCTGC -3'
(R):5'- GCAGTTTCACAGTCAAGGC -3'
Posted On 2014-04-13