Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Ints8'

169431

Institutional Source

Beutler Lab

Gene Symbol

Ints8

Ensembl Gene

ENSMUSG00000040738

Gene Name

integrator complex subunit 8

Synonyms

2810013E07Rik, D130008D20Rik

MMRRC Submission

039553-MU

Accession Numbers

Ncbi RefSeq: NM_001159595.1, NM_178112.5; MGI:1919906

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11199158-11254258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 11245842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 212 (L212Q)

Ref Sequence

ENSEMBL: ENSMUSP00000103954 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]

AlphaFold

Q80V86

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044616
AA Change: L212Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: L212Q

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108318
AA Change: L212Q

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: L212Q

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC
SCOP:d1a17__	826	961	9e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108319
AA Change: L212Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: L212Q

Domain	Start	End	E-Value	Type
low complexity region	25	35	N/A	INTRINSIC
low complexity region	80	93	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Ints8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01390:Ints8	APN	4	11218679	splice site	probably benign
IGL01925:Ints8	APN	4	11235617	splice site	probably benign
IGL02195:Ints8	APN	4	11221222	missense	probably damaging	1.00
IGL02215:Ints8	APN	4	11209244	missense	probably damaging	1.00
IGL02429:Ints8	APN	4	11231720	missense	probably damaging	1.00
IGL02484:Ints8	APN	4	11208834	nonsense	probably null
IGL02558:Ints8	APN	4	11218771	missense	probably damaging	1.00
IGL02725:Ints8	APN	4	11239406	missense	probably benign	0.01
IGL02742:Ints8	APN	4	11241627	missense	possibly damaging	0.75
IGL02831:Ints8	APN	4	11245896	missense	possibly damaging	0.51
IGL03140:Ints8	APN	4	11235565	missense	probably damaging	1.00
IGL03171:Ints8	APN	4	11231702	missense	probably benign	0.01
IGL03335:Ints8	APN	4	11216460	missense	probably damaging	1.00
G1Funyon:Ints8	UTSW	4	11246120	missense	probably damaging	1.00
P0026:Ints8	UTSW	4	11225788	nonsense	probably null
R0054:Ints8	UTSW	4	11204595	utr 3 prime	probably benign
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0063:Ints8	UTSW	4	11252857	missense	probably damaging	1.00
R0184:Ints8	UTSW	4	11218637	missense	probably benign	0.03
R0299:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R0499:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R0540:Ints8	UTSW	4	11252926	missense	possibly damaging	0.94
R0657:Ints8	UTSW	4	11246097	missense	probably benign	0.04
R1232:Ints8	UTSW	4	11234587	missense	possibly damaging	0.81
R1296:Ints8	UTSW	4	11221204	missense	possibly damaging	0.95
R1390:Ints8	UTSW	4	11239461	missense	probably benign	0.22
R1587:Ints8	UTSW	4	11245722	critical splice donor site	probably null
R1701:Ints8	UTSW	4	11231656	missense	probably damaging	1.00
R1721:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1757:Ints8	UTSW	4	11254109	start codon destroyed	probably null	0.99
R1777:Ints8	UTSW	4	11225600	critical splice donor site	probably null
R1867:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1868:Ints8	UTSW	4	11241684	missense	probably damaging	0.97
R1952:Ints8	UTSW	4	11221150	missense	probably benign	0.21
R2084:Ints8	UTSW	4	11230377	missense	probably benign	0.31
R2108:Ints8	UTSW	4	11235552	missense	probably damaging	0.99
R2202:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2203:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2205:Ints8	UTSW	4	11225712	missense	possibly damaging	0.79
R2439:Ints8	UTSW	4	11225725	missense	probably benign	0.29
R2504:Ints8	UTSW	4	11241642	missense	probably benign	0.03
R3824:Ints8	UTSW	4	11225621	nonsense	probably null
R4664:Ints8	UTSW	4	11227152	missense	probably benign	0.04
R4703:Ints8	UTSW	4	11223785	missense	possibly damaging	0.92
R4895:Ints8	UTSW	4	11230367	nonsense	probably null
R5206:Ints8	UTSW	4	11216477	missense	possibly damaging	0.65
R5262:Ints8	UTSW	4	11211916	missense	probably damaging	1.00
R5505:Ints8	UTSW	4	11221143	missense	probably benign	0.18
R5513:Ints8	UTSW	4	11248303	missense	possibly damaging	0.79
R5750:Ints8	UTSW	4	11241654	missense	possibly damaging	0.81
R5892:Ints8	UTSW	4	11223813	missense	probably damaging	1.00
R6007:Ints8	UTSW	4	11208845	missense	possibly damaging	0.70
R6229:Ints8	UTSW	4	11252891	missense	probably damaging	1.00
R6466:Ints8	UTSW	4	11252878	missense	probably damaging	0.99
R6709:Ints8	UTSW	4	11221117	missense	possibly damaging	0.65
R6986:Ints8	UTSW	4	11204474	missense	probably damaging	1.00
R6998:Ints8	UTSW	4	11204537	missense	possibly damaging	0.80
R7074:Ints8	UTSW	4	11204574	missense	possibly damaging	0.82
R7221:Ints8	UTSW	4	11225613	missense	probably benign	0.01
R7772:Ints8	UTSW	4	11227190	missense	probably damaging	0.97
R7872:Ints8	UTSW	4	11254062	missense	probably benign	0.00
R7953:Ints8	UTSW	4	11227128	missense	probably benign
R8184:Ints8	UTSW	4	11204534	missense	probably damaging	1.00
R8301:Ints8	UTSW	4	11246120	missense	probably damaging	1.00
R8708:Ints8	UTSW	4	11208824	critical splice donor site	probably null
R8868:Ints8	UTSW	4	11230488	missense	probably benign
R9245:Ints8	UTSW	4	11213811	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTACGTGTTGATAATCCCAGCAG -3'
(R):5'- TGCAAAGCACTTGAGAAGGCCC -3'

Sequencing Primer
(F):5'- aaaataaagacagacagacagacag -3'
(R):5'- CTTCATGCTGAAGAACGAGAGTC -3'

Posted On

2014-04-13