Incidental Mutation 'R1503:Ints8'
ID 169431
Institutional Source Beutler Lab
Gene Symbol Ints8
Ensembl Gene ENSMUSG00000040738
Gene Name integrator complex subunit 8
Synonyms 2810013E07Rik, D130008D20Rik
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 11199158-11254258 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11245842 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 212 (L212Q)
Ref Sequence ENSEMBL: ENSMUSP00000103954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044616] [ENSMUST00000108318] [ENSMUST00000108319]
AlphaFold Q80V86
Predicted Effect possibly damaging
Transcript: ENSMUST00000044616
AA Change: L212Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738
AA Change: L212Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108318
AA Change: L212Q

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103954
Gene: ENSMUSG00000040738
AA Change: L212Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
SCOP:d1a17__ 826 961 9e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108319
AA Change: L212Q

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103955
Gene: ENSMUSG00000040738
AA Change: L212Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI

All alleles(14) : Targeted(1) Gene trapped(13)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Ints8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Ints8 APN 4 11,218,679 (GRCm39) splice site probably benign
IGL01925:Ints8 APN 4 11,235,617 (GRCm39) splice site probably benign
IGL02195:Ints8 APN 4 11,221,222 (GRCm39) missense probably damaging 1.00
IGL02215:Ints8 APN 4 11,209,244 (GRCm39) missense probably damaging 1.00
IGL02429:Ints8 APN 4 11,231,720 (GRCm39) missense probably damaging 1.00
IGL02484:Ints8 APN 4 11,208,834 (GRCm39) nonsense probably null
IGL02558:Ints8 APN 4 11,218,771 (GRCm39) missense probably damaging 1.00
IGL02725:Ints8 APN 4 11,239,406 (GRCm39) missense probably benign 0.01
IGL02742:Ints8 APN 4 11,241,627 (GRCm39) missense possibly damaging 0.75
IGL02831:Ints8 APN 4 11,245,896 (GRCm39) missense possibly damaging 0.51
IGL03140:Ints8 APN 4 11,235,565 (GRCm39) missense probably damaging 1.00
IGL03171:Ints8 APN 4 11,231,702 (GRCm39) missense probably benign 0.01
IGL03335:Ints8 APN 4 11,216,460 (GRCm39) missense probably damaging 1.00
G1Funyon:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
P0026:Ints8 UTSW 4 11,225,788 (GRCm39) nonsense probably null
R0054:Ints8 UTSW 4 11,204,595 (GRCm39) utr 3 prime probably benign
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0063:Ints8 UTSW 4 11,252,857 (GRCm39) missense probably damaging 1.00
R0184:Ints8 UTSW 4 11,218,637 (GRCm39) missense probably benign 0.03
R0299:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0499:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R0540:Ints8 UTSW 4 11,252,926 (GRCm39) missense possibly damaging 0.94
R0657:Ints8 UTSW 4 11,246,097 (GRCm39) missense probably benign 0.04
R1232:Ints8 UTSW 4 11,234,587 (GRCm39) missense possibly damaging 0.81
R1296:Ints8 UTSW 4 11,221,204 (GRCm39) missense possibly damaging 0.95
R1390:Ints8 UTSW 4 11,239,461 (GRCm39) missense probably benign 0.22
R1587:Ints8 UTSW 4 11,245,722 (GRCm39) critical splice donor site probably null
R1701:Ints8 UTSW 4 11,231,656 (GRCm39) missense probably damaging 1.00
R1721:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1757:Ints8 UTSW 4 11,254,109 (GRCm39) start codon destroyed probably null 0.99
R1777:Ints8 UTSW 4 11,225,600 (GRCm39) critical splice donor site probably null
R1867:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1868:Ints8 UTSW 4 11,241,684 (GRCm39) missense probably damaging 0.97
R1952:Ints8 UTSW 4 11,221,150 (GRCm39) missense probably benign 0.21
R2084:Ints8 UTSW 4 11,230,377 (GRCm39) missense probably benign 0.31
R2108:Ints8 UTSW 4 11,235,552 (GRCm39) missense probably damaging 0.99
R2202:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2203:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2205:Ints8 UTSW 4 11,225,712 (GRCm39) missense possibly damaging 0.79
R2439:Ints8 UTSW 4 11,225,725 (GRCm39) missense probably benign 0.29
R2504:Ints8 UTSW 4 11,241,642 (GRCm39) missense probably benign 0.03
R3824:Ints8 UTSW 4 11,225,621 (GRCm39) nonsense probably null
R4664:Ints8 UTSW 4 11,227,152 (GRCm39) missense probably benign 0.04
R4703:Ints8 UTSW 4 11,223,785 (GRCm39) missense possibly damaging 0.92
R4895:Ints8 UTSW 4 11,230,367 (GRCm39) nonsense probably null
R5206:Ints8 UTSW 4 11,216,477 (GRCm39) missense possibly damaging 0.65
R5262:Ints8 UTSW 4 11,211,916 (GRCm39) missense probably damaging 1.00
R5505:Ints8 UTSW 4 11,221,143 (GRCm39) missense probably benign 0.18
R5513:Ints8 UTSW 4 11,248,303 (GRCm39) missense possibly damaging 0.79
R5750:Ints8 UTSW 4 11,241,654 (GRCm39) missense possibly damaging 0.81
R5892:Ints8 UTSW 4 11,223,813 (GRCm39) missense probably damaging 1.00
R6007:Ints8 UTSW 4 11,208,845 (GRCm39) missense possibly damaging 0.70
R6229:Ints8 UTSW 4 11,252,891 (GRCm39) missense probably damaging 1.00
R6466:Ints8 UTSW 4 11,252,878 (GRCm39) missense probably damaging 0.99
R6709:Ints8 UTSW 4 11,221,117 (GRCm39) missense possibly damaging 0.65
R6986:Ints8 UTSW 4 11,204,474 (GRCm39) missense probably damaging 1.00
R6998:Ints8 UTSW 4 11,204,537 (GRCm39) missense possibly damaging 0.80
R7074:Ints8 UTSW 4 11,204,574 (GRCm39) missense possibly damaging 0.82
R7221:Ints8 UTSW 4 11,225,613 (GRCm39) missense probably benign 0.01
R7772:Ints8 UTSW 4 11,227,190 (GRCm39) missense probably damaging 0.97
R7872:Ints8 UTSW 4 11,254,062 (GRCm39) missense probably benign 0.00
R7953:Ints8 UTSW 4 11,227,128 (GRCm39) missense probably benign
R8184:Ints8 UTSW 4 11,204,534 (GRCm39) missense probably damaging 1.00
R8301:Ints8 UTSW 4 11,246,120 (GRCm39) missense probably damaging 1.00
R8708:Ints8 UTSW 4 11,208,824 (GRCm39) critical splice donor site probably null
R8868:Ints8 UTSW 4 11,230,488 (GRCm39) missense probably benign
R9245:Ints8 UTSW 4 11,213,811 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTACGTGTTGATAATCCCAGCAG -3'
(R):5'- TGCAAAGCACTTGAGAAGGCCC -3'

Sequencing Primer
(F):5'- aaaataaagacagacagacagacag -3'
(R):5'- CTTCATGCTGAAGAACGAGAGTC -3'
Posted On 2014-04-13