Incidental Mutation 'R1503:Or6z6'
ID 169443
Institutional Source Beutler Lab
Gene Symbol Or6z6
Ensembl Gene ENSMUSG00000034583
Gene Name olfactory receptor family 6 subfamily Z member 6
Synonyms Olfr1347, GA_x6K02T2QGBW-3218686-3217748, MOR103-11, MOR103-19_i
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R1503 (G1)
Quality Score 98
Status Not validated
Chromosome 7
Chromosomal Location 6490912-6491871 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6491178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 232 (I232V)
Ref Sequence ENSEMBL: ENSMUSP00000152024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036357] [ENSMUST00000086318] [ENSMUST00000207339] [ENSMUST00000209055] [ENSMUST00000209866] [ENSMUST00000220413]
AlphaFold Q8VF33
Predicted Effect probably damaging
Transcript: ENSMUST00000036357
AA Change: I225V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046590
Gene: ENSMUSG00000034583
AA Change: I225V

DomainStartEndE-ValueType
Pfam:7tm_4 42 318 2.5e-50 PFAM
Pfam:7tm_1 52 301 2.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086318
SMART Domains Protein: ENSMUSP00000083498
Gene: ENSMUSG00000096228

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.1e-50 PFAM
Pfam:7tm_1 45 294 6.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207339
AA Change: I225V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000209055
Predicted Effect probably benign
Transcript: ENSMUST00000209866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218572
Predicted Effect probably damaging
Transcript: ENSMUST00000220413
AA Change: I232V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Or6z6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02395:Or6z6 APN 7 6,491,802 (GRCm39) missense possibly damaging 0.83
R0277:Or6z6 UTSW 7 6,491,433 (GRCm39) missense probably benign 0.00
R0891:Or6z6 UTSW 7 6,491,471 (GRCm39) missense probably damaging 1.00
R1394:Or6z6 UTSW 7 6,491,361 (GRCm39) missense probably damaging 1.00
R1395:Or6z6 UTSW 7 6,491,361 (GRCm39) missense probably damaging 1.00
R3014:Or6z6 UTSW 7 6,491,470 (GRCm39) nonsense probably null
R5194:Or6z6 UTSW 7 6,491,519 (GRCm39) missense probably damaging 1.00
R5477:Or6z6 UTSW 7 6,491,570 (GRCm39) missense probably benign 0.00
R6137:Or6z6 UTSW 7 6,491,844 (GRCm39) missense probably benign 0.02
R6212:Or6z6 UTSW 7 6,491,367 (GRCm39) splice site probably null
R6706:Or6z6 UTSW 7 6,491,049 (GRCm39) missense probably damaging 1.00
R7444:Or6z6 UTSW 7 6,490,919 (GRCm39) missense probably benign 0.00
Z1176:Or6z6 UTSW 7 6,491,697 (GRCm39) missense probably damaging 0.98
Z1176:Or6z6 UTSW 7 6,491,691 (GRCm39) missense probably benign 0.00
Z1177:Or6z6 UTSW 7 6,491,203 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAGACAGCACCTTGTTGAGGTCC -3'
(R):5'- TATGTAGCCATTTGCCGCCCAC -3'

Sequencing Primer
(F):5'- GCTGCTGAGTAAAAGATGCC -3'
(R):5'- TCTCGGCGATAAAGACAAAATGC -3'
Posted On 2014-04-13