Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Dnhd1'

169447

Institutional Source

Beutler Lab

Gene Symbol

Dnhd1

Ensembl Gene

ENSMUSG00000030882

Gene Name

dynein heavy chain domain 1

Synonyms

8030491N06Rik

MMRRC Submission

039553-MU

Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2: ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105650827-105721799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 105693660 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 1404 (S1404A)

Ref Sequence

ENSEMBL: ENSMUSP00000121261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000145988]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118658

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145988
AA Change: S1404A

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: S1404A

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	102	115	N/A	INTRINSIC
low complexity region	183	191	N/A	INTRINSIC
low complexity region	253	269	N/A	INTRINSIC
low complexity region	943	962	N/A	INTRINSIC
Pfam:DHC_N2	1018	1472	4.6e-50	PFAM
Pfam:AAA_6	1652	1875	2.7e-14	PFAM
low complexity region	1906	1918	N/A	INTRINSIC
Blast:AAA	1993	2196	1e-34	BLAST
Pfam:AAA_7	2362	2610	3.3e-11	PFAM
low complexity region	2697	2714	N/A	INTRINSIC
low complexity region	2722	2733	N/A	INTRINSIC
low complexity region	2800	2810	N/A	INTRINSIC
low complexity region	3116	3134	N/A	INTRINSIC
Pfam:MT	3178	3470	3.9e-16	PFAM
coiled coil region	3590	3642	N/A	INTRINSIC
coiled coil region	3816	3843	N/A	INTRINSIC
Pfam:Dynein_heavy	3976	4746	7.3e-97	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Dnhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Dnhd1	APN	7	105677995	missense	probably damaging	1.00
IGL00516:Dnhd1	APN	7	105657211	missense	possibly damaging	0.52
IGL00576:Dnhd1	APN	7	105692675	missense	probably damaging	1.00
IGL00990:Dnhd1	APN	7	105721688	missense	possibly damaging	0.85
IGL01346:Dnhd1	APN	7	105713909	missense	probably benign
IGL01714:Dnhd1	APN	7	105720942	missense	probably damaging	1.00
IGL01735:Dnhd1	APN	7	105713754	missense	probably benign	0.37
IGL01814:Dnhd1	APN	7	105652030	missense	probably benign
IGL01999:Dnhd1	APN	7	105721215	missense	possibly damaging	0.50
IGL02022:Dnhd1	APN	7	105678309	missense	probably damaging	1.00
IGL02131:Dnhd1	APN	7	105720802	missense	probably damaging	1.00
IGL02156:Dnhd1	APN	7	105721744	missense	probably damaging	1.00
IGL02674:Dnhd1	APN	7	105721481	missense	probably benign	0.00
IGL02966:Dnhd1	APN	7	105720741	missense	probably benign	0.00
IGL03066:Dnhd1	APN	7	105719882	missense	probably damaging	0.99
IGL03298:Dnhd1	APN	7	105714475	missense	probably damaging	0.98
IGL03378:Dnhd1	APN	7	105713733	missense	possibly damaging	0.87
IGL02802:Dnhd1	UTSW	7	105655723	missense	possibly damaging	0.83
R0060:Dnhd1	UTSW	7	105668514	missense	probably damaging	0.99
R0129:Dnhd1	UTSW	7	105720924	missense	probably benign	0.19
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0238:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0239:Dnhd1	UTSW	7	105721531	missense	probably benign	0.06
R0384:Dnhd1	UTSW	7	105720114	missense	possibly damaging	0.56
R0453:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R0540:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0554:Dnhd1	UTSW	7	105694395	missense	probably benign	0.10
R0576:Dnhd1	UTSW	7	105714045	missense	probably damaging	1.00
R0607:Dnhd1	UTSW	7	105720788	missense	probably benign	0.04
R0631:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R0639:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0668:Dnhd1	UTSW	7	105695751	missense	probably benign
R0669:Dnhd1	UTSW	7	105693704	missense	probably benign	0.01
R0670:Dnhd1	UTSW	7	105696464	missense	possibly damaging	0.95
R0699:Dnhd1	UTSW	7	105651906	missense	probably damaging	0.98
R1019:Dnhd1	UTSW	7	105709171	missense	probably damaging	1.00
R1144:Dnhd1	UTSW	7	105713031	missense	probably damaging	1.00
R1226:Dnhd1	UTSW	7	105696899	missense	probably damaging	1.00
R1257:Dnhd1	UTSW	7	105694153	missense	probably damaging	1.00
R1391:Dnhd1	UTSW	7	105720124	missense	probably damaging	1.00
R1453:Dnhd1	UTSW	7	105721273	critical splice donor site	probably null
R1501:Dnhd1	UTSW	7	105668463	missense	probably benign	0.00
R1515:Dnhd1	UTSW	7	105704148	missense	probably benign	0.11
R1615:Dnhd1	UTSW	7	105703206	missense	probably benign	0.00
R1615:Dnhd1	UTSW	7	105713706	missense	possibly damaging	0.74
R1656:Dnhd1	UTSW	7	105714281	missense	probably damaging	1.00
R1720:Dnhd1	UTSW	7	105693828	missense	probably benign
R1723:Dnhd1	UTSW	7	105714920	missense	possibly damaging	0.60
R1766:Dnhd1	UTSW	7	105693972	missense	possibly damaging	0.50
R1799:Dnhd1	UTSW	7	105655767	missense	probably benign	0.31
R1860:Dnhd1	UTSW	7	105704205	missense	probably benign
R1920:Dnhd1	UTSW	7	105713407	missense	probably benign	0.00
R1925:Dnhd1	UTSW	7	105652252	missense	probably damaging	1.00
R1925:Dnhd1	UTSW	7	105673854	missense	probably damaging	0.96
R1934:Dnhd1	UTSW	7	105708582	missense	probably benign	0.05
R1935:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R1936:Dnhd1	UTSW	7	105673976	missense	probably benign	0.09
R2035:Dnhd1	UTSW	7	105704921	missense	probably damaging	0.99
R2125:Dnhd1	UTSW	7	105677971	missense	probably benign	0.35
R2127:Dnhd1	UTSW	7	105693721	missense	possibly damaging	0.56
R2254:Dnhd1	UTSW	7	105703772	missense	probably damaging	1.00
R2301:Dnhd1	UTSW	7	105705399	missense	probably damaging	1.00
R2316:Dnhd1	UTSW	7	105674421	missense	probably damaging	1.00
R2324:Dnhd1	UTSW	7	105710090	missense	probably damaging	1.00
R2337:Dnhd1	UTSW	7	105703467	missense	probably benign	0.07
R2381:Dnhd1	UTSW	7	105693664	missense	probably benign	0.42
R2394:Dnhd1	UTSW	7	105720231	missense	probably benign	0.19
R2862:Dnhd1	UTSW	7	105712559	missense	probably benign	0.01
R3038:Dnhd1	UTSW	7	105720229	missense	probably damaging	0.99
R3114:Dnhd1	UTSW	7	105696565	critical splice donor site	probably null
R3404:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3405:Dnhd1	UTSW	7	105694761	nonsense	probably null
R3439:Dnhd1	UTSW	7	105694785	missense	probably damaging	1.00
R3959:Dnhd1	UTSW	7	105713122	missense	probably benign	0.21
R4014:Dnhd1	UTSW	7	105714838	missense	probably damaging	0.99
R4084:Dnhd1	UTSW	7	105709588	missense	probably damaging	1.00
R4181:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4255:Dnhd1	UTSW	7	105712998	missense	probably damaging	1.00
R4302:Dnhd1	UTSW	7	105693954	missense	probably damaging	1.00
R4440:Dnhd1	UTSW	7	105696728	nonsense	probably null
R4565:Dnhd1	UTSW	7	105651956	missense	possibly damaging	0.92
R4569:Dnhd1	UTSW	7	105657166	splice site	probably null
R4584:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4586:Dnhd1	UTSW	7	105678049	missense	probably damaging	1.00
R4590:Dnhd1	UTSW	7	105714030	missense	probably damaging	1.00
R4593:Dnhd1	UTSW	7	105715446	missense	probably benign	0.02
R4600:Dnhd1	UTSW	7	105703644	missense	probably damaging	1.00
R4705:Dnhd1	UTSW	7	105655741	missense	probably damaging	1.00
R4731:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4732:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4733:Dnhd1	UTSW	7	105673849	missense	probably benign	0.00
R4786:Dnhd1	UTSW	7	105674444	missense	probably benign	0.00
R4791:Dnhd1	UTSW	7	105721117	missense	probably damaging	1.00
R4811:Dnhd1	UTSW	7	105714281	missense	probably damaging	0.99
R4822:Dnhd1	UTSW	7	105703964	missense	probably benign	0.00
R4886:Dnhd1	UTSW	7	105714808	missense	probably benign	0.00
R4890:Dnhd1	UTSW	7	105656957	missense	possibly damaging	0.47
R4973:Dnhd1	UTSW	7	105713633	missense	probably benign	0.24
R5007:Dnhd1	UTSW	7	105713076	missense	probably damaging	1.00
R5048:Dnhd1	UTSW	7	105693697	missense	probably benign	0.01
R5151:Dnhd1	UTSW	7	105713440	missense	probably benign	0.22
R5179:Dnhd1	UTSW	7	105714552	missense	probably damaging	1.00
R5182:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5183:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5185:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5209:Dnhd1	UTSW	7	105696460	missense	probably benign	0.00
R5225:Dnhd1	UTSW	7	105703923	missense	possibly damaging	0.73
R5250:Dnhd1	UTSW	7	105685761	missense	probably damaging	1.00
R5257:Dnhd1	UTSW	7	105674037	missense	probably benign
R5258:Dnhd1	UTSW	7	105674037	missense	probably benign
R5273:Dnhd1	UTSW	7	105714482	missense	probably damaging	0.99
R5288:Dnhd1	UTSW	7	105714437	missense	possibly damaging	0.94
R5396:Dnhd1	UTSW	7	105713684	missense	probably benign	0.00
R5453:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R5511:Dnhd1	UTSW	7	105714156	missense	probably damaging	1.00
R5518:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5523:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5528:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5529:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5561:Dnhd1	UTSW	7	105714821	missense	probably damaging	0.99
R5681:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5682:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5683:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5684:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5686:Dnhd1	UTSW	7	105703209	missense	probably damaging	1.00
R5697:Dnhd1	UTSW	7	105674188	missense	probably damaging	1.00
R5789:Dnhd1	UTSW	7	105705010	missense	possibly damaging	0.50
R5790:Dnhd1	UTSW	7	105655774	missense	probably damaging	1.00
R5814:Dnhd1	UTSW	7	105719895	missense	possibly damaging	0.69
R5828:Dnhd1	UTSW	7	105720181	missense	probably benign	0.00
R5852:Dnhd1	UTSW	7	105695748	missense	probably damaging	1.00
R5883:Dnhd1	UTSW	7	105720504	missense	probably damaging	0.98
R6115:Dnhd1	UTSW	7	105713987	missense	probably benign	0.00
R6119:Dnhd1	UTSW	7	105709440	missense	probably benign	0.18
R6212:Dnhd1	UTSW	7	105704048	missense	probably damaging	1.00
R6243:Dnhd1	UTSW	7	105652009	missense	probably damaging	1.00
R6265:Dnhd1	UTSW	7	105693370	missense	probably benign	0.07
R6332:Dnhd1	UTSW	7	105694066	missense	probably benign	0.02
R6344:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R6477:Dnhd1	UTSW	7	105677886	missense	probably benign	0.05
R6642:Dnhd1	UTSW	7	105703799	missense	probably benign
R6663:Dnhd1	UTSW	7	105685692	splice site	probably null
R6730:Dnhd1	UTSW	7	105703875	missense	probably benign	0.00
R6748:Dnhd1	UTSW	7	105720637	missense	probably benign	0.03
R6833:Dnhd1	UTSW	7	105703373	missense	probably benign	0.01
R6850:Dnhd1	UTSW	7	105719930	missense	possibly damaging	0.68
R6853:Dnhd1	UTSW	7	105703728	missense	probably benign
R6860:Dnhd1	UTSW	7	105678266	missense	probably benign
R6898:Dnhd1	UTSW	7	105687377	missense	probably damaging	0.99
R6927:Dnhd1	UTSW	7	105715563	missense	probably damaging	1.00
R6952:Dnhd1	UTSW	7	105713688	missense	probably damaging	1.00
R6987:Dnhd1	UTSW	7	105704585	missense	probably damaging	0.98
R6988:Dnhd1	UTSW	7	105714210	missense	probably damaging	1.00
R7022:Dnhd1	UTSW	7	105720798	missense	probably benign	0.36
R7053:Dnhd1	UTSW	7	105694954	missense	probably damaging	1.00
R7085:Dnhd1	UTSW	7	105715261	missense	probably benign	0.26
R7086:Dnhd1	UTSW	7	105708532	missense	probably benign	0.03
R7112:Dnhd1	UTSW	7	105713985	missense	probably damaging	1.00
R7140:Dnhd1	UTSW	7	105693766	missense	probably benign	0.00
R7151:Dnhd1	UTSW	7	105710027	missense	probably benign	0.03
R7178:Dnhd1	UTSW	7	105694993	missense	probably damaging	0.98
R7326:Dnhd1	UTSW	7	105720930	missense	probably damaging	0.96
R7345:Dnhd1	UTSW	7	105703967	missense	probably benign	0.17
R7349:Dnhd1	UTSW	7	105710123	missense	probably damaging	1.00
R7397:Dnhd1	UTSW	7	105705297	missense	possibly damaging	0.87
R7520:Dnhd1	UTSW	7	105696048	missense	probably benign	0.07
R7536:Dnhd1	UTSW	7	105709561	missense	probably damaging	1.00
R7539:Dnhd1	UTSW	7	105720912	missense	probably damaging	1.00
R7541:Dnhd1	UTSW	7	105678309	missense	probably damaging	1.00
R7619:Dnhd1	UTSW	7	105674268	missense	probably benign	0.01
R7676:Dnhd1	UTSW	7	105684087	missense	probably benign	0.09
R7689:Dnhd1	UTSW	7	105713963	missense	probably benign	0.07
R7712:Dnhd1	UTSW	7	105651624	missense	probably benign	0.17
R7729:Dnhd1	UTSW	7	105705265	missense	probably damaging	1.00
R7767:Dnhd1	UTSW	7	105694610	missense	probably benign	0.38
R7768:Dnhd1	UTSW	7	105721095	missense	possibly damaging	0.87
R7779:Dnhd1	UTSW	7	105677915	missense	probably benign	0.01
R7879:Dnhd1	UTSW	7	105703439	missense	probably benign	0.09
R7922:Dnhd1	UTSW	7	105668514	missense	probably damaging	1.00
R7951:Dnhd1	UTSW	7	105678004	missense	probably damaging	1.00
R8259:Dnhd1	UTSW	7	105694788	missense	probably benign	0.38
R8350:Dnhd1	UTSW	7	105678024	missense	probably damaging	0.99
R8380:Dnhd1	UTSW	7	105677866	missense	probably benign	0.31
R8392:Dnhd1	UTSW	7	105703343	missense	possibly damaging	0.84
R8478:Dnhd1	UTSW	7	105682794	missense	probably benign	0.00
R8708:Dnhd1	UTSW	7	105694280	nonsense	probably null
R8767:Dnhd1	UTSW	7	105652123	missense	probably damaging	1.00
R8825:Dnhd1	UTSW	7	105693967	missense	possibly damaging	0.95
R8849:Dnhd1	UTSW	7	105721516	missense	probably benign	0.00
R8903:Dnhd1	UTSW	7	105713648	nonsense	probably null
R8910:Dnhd1	UTSW	7	105683697	missense	possibly damaging	0.92
R8940:Dnhd1	UTSW	7	105714647	intron	probably benign
R8954:Dnhd1	UTSW	7	105694779	missense	probably benign	0.35
R8956:Dnhd1	UTSW	7	105692645	missense	probably damaging	0.99
R8971:Dnhd1	UTSW	7	105709321	nonsense	probably null
R8996:Dnhd1	UTSW	7	105674035	missense	probably damaging	1.00
R9051:Dnhd1	UTSW	7	105692726	missense	possibly damaging	0.54
R9058:Dnhd1	UTSW	7	105684063	missense	probably benign	0.01
R9109:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9284:Dnhd1	UTSW	7	105651884	missense	probably damaging	1.00
R9295:Dnhd1	UTSW	7	105714141	missense	probably benign
R9298:Dnhd1	UTSW	7	105683966	missense	probably damaging	0.98
R9299:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9308:Dnhd1	UTSW	7	105704277	missense	probably damaging	1.00
R9337:Dnhd1	UTSW	7	105720599	missense	probably benign	0.00
R9385:Dnhd1	UTSW	7	105712765	missense	probably damaging	1.00
R9463:Dnhd1	UTSW	7	105657247	missense	probably benign	0.00
R9463:Dnhd1	UTSW	7	105695016	missense	probably benign
R9476:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9489:Dnhd1	UTSW	7	105651597	missense	probably benign
R9500:Dnhd1	UTSW	7	105704502	missense	probably benign
R9510:Dnhd1	UTSW	7	105703682	missense	possibly damaging	0.74
R9513:Dnhd1	UTSW	7	105704972	missense	probably damaging	1.00
R9537:Dnhd1	UTSW	7	105695533	missense	probably damaging	0.99
R9567:Dnhd1	UTSW	7	105704266	missense	probably benign	0.03
R9622:Dnhd1	UTSW	7	105704135	missense	probably benign
R9623:Dnhd1	UTSW	7	105686566	missense	probably damaging	1.00
R9623:Dnhd1	UTSW	7	105694927	missense	probably damaging	1.00
R9674:Dnhd1	UTSW	7	105714222	missense	probably damaging	1.00
R9756:Dnhd1	UTSW	7	105703928	missense	probably benign	0.19
R9777:Dnhd1	UTSW	7	105720249	missense	probably benign	0.14
R9778:Dnhd1	UTSW	7	105704033	missense	probably benign
R9781:Dnhd1	UTSW	7	105703710	missense	probably benign	0.31
R9796:Dnhd1	UTSW	7	105693330	missense	probably damaging	1.00
Z1088:Dnhd1	UTSW	7	105712727	missense	probably benign	0.00
Z1176:Dnhd1	UTSW	7	105668547	missense	probably damaging	0.98
Z1176:Dnhd1	UTSW	7	105678299	missense	probably benign
Z1176:Dnhd1	UTSW	7	105703036	critical splice acceptor site	probably null
Z1176:Dnhd1	UTSW	7	105703580	frame shift	probably null
Z1177:Dnhd1	UTSW	7	105682841	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CCTTACTTCCAAGGCCAGCATCTAC -3'
(R):5'- TGGACATACACTTGCATGGGCATC -3'

Sequencing Primer
(F):5'- AGAGCTGGAGGCCATCATC -3'
(R):5'- TGAGGCATTGCCTTCAAAGC -3'

Posted On

2014-04-13