Incidental Mutation 'R1503:Hmbs'
ID 169458
Institutional Source Beutler Lab
Gene Symbol Hmbs
Ensembl Gene ENSMUSG00000032126
Gene Name hydroxymethylbilane synthase
Synonyms Uros1, Ups, porphobilinogen deaminase, PBGD
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44247645-44255525 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 44248729 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 215 (L215W)
Ref Sequence ENSEMBL: ENSMUSP00000095166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052686] [ENSMUST00000054708] [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215050] [ENSMUST00000216852] [ENSMUST00000215091]
AlphaFold P22907
Predicted Effect probably benign
Transcript: ENSMUST00000052686
SMART Domains Protein: ENSMUSP00000051432
Gene: ENSMUSG00000049932

DomainStartEndE-ValueType
H2A 3 123 1.64e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054708
SMART Domains Protein: ENSMUSP00000056282
Gene: ENSMUSG00000032123

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Glycos_transf_4 100 272 1.1e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077353
AA Change: L232W

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126
AA Change: L232W

DomainStartEndE-ValueType
Pfam:Porphobil_deam 21 233 1.7e-79 PFAM
Pfam:Porphobil_deamC 244 323 6.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097558
AA Change: L215W

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126
AA Change: L215W

DomainStartEndE-ValueType
Pfam:Porphobil_deam 3 219 3.9e-95 PFAM
Pfam:Porphobil_deamC 227 327 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214967
Predicted Effect probably benign
Transcript: ENSMUST00000215050
Predicted Effect unknown
Transcript: ENSMUST00000216658
AA Change: L48W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215934
Predicted Effect probably benign
Transcript: ENSMUST00000216852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215859
Predicted Effect probably benign
Transcript: ENSMUST00000215091
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for one null allele and a functional allele with a milder mutation exhibit typical features of acute intermittent porphyria with massive urinary excretion of aminolevulinic acid after phenobarbital treatment, erythruria, ataxia, motor dysfunction, and neurologic muscle atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Hmbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Hmbs APN 9 44,250,845 (GRCm39) missense possibly damaging 0.91
IGL02312:Hmbs APN 9 44,252,510 (GRCm39) critical splice donor site probably null
R0386:Hmbs UTSW 9 44,248,305 (GRCm39) missense probably benign 0.06
R0411:Hmbs UTSW 9 44,252,949 (GRCm39) nonsense probably null
R0656:Hmbs UTSW 9 44,248,657 (GRCm39) missense probably benign 0.31
R1560:Hmbs UTSW 9 44,248,657 (GRCm39) missense possibly damaging 0.71
R1953:Hmbs UTSW 9 44,248,741 (GRCm39) missense probably damaging 1.00
R2127:Hmbs UTSW 9 44,252,004 (GRCm39) missense probably benign 0.09
R4637:Hmbs UTSW 9 44,250,834 (GRCm39) missense probably damaging 1.00
R5549:Hmbs UTSW 9 44,250,774 (GRCm39) critical splice donor site probably null
R6611:Hmbs UTSW 9 44,252,988 (GRCm39) missense probably damaging 0.98
R7509:Hmbs UTSW 9 44,248,208 (GRCm39) missense
R7702:Hmbs UTSW 9 44,248,147 (GRCm39) splice site probably null
R8383:Hmbs UTSW 9 44,249,240 (GRCm39) missense probably damaging 1.00
R8506:Hmbs UTSW 9 44,252,921 (GRCm39) critical splice donor site probably null
R9069:Hmbs UTSW 9 44,248,102 (GRCm39) missense possibly damaging 0.79
R9149:Hmbs UTSW 9 44,252,983 (GRCm39) nonsense probably null
R9780:Hmbs UTSW 9 44,247,985 (GRCm39) missense probably damaging 1.00
X0024:Hmbs UTSW 9 44,249,265 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATGGAAATGACAGTCCCTCCCCTC -3'
(R):5'- TGGTTCATAACCTTTGGCACCTGC -3'

Sequencing Primer
(F):5'- TTTTGACCACAGACCTCAAGGG -3'
(R):5'- GGCACCTGCTATCCATCAAATAAG -3'
Posted On 2014-04-13