Incidental Mutation 'R1503:Hmbs'
ID 169458
Institutional Source Beutler Lab
Gene Symbol Hmbs
Ensembl Gene ENSMUSG00000032126
Gene Name hydroxymethylbilane synthase
Synonyms porphobilinogen deaminase, PBGD, Uros1, Ups
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 44336339-44344228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 44337432 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Tryptophan at position 215 (L215W)
Ref Sequence ENSEMBL: ENSMUSP00000095166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052686] [ENSMUST00000054708] [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215050] [ENSMUST00000215091] [ENSMUST00000216852]
AlphaFold P22907
Predicted Effect probably benign
Transcript: ENSMUST00000052686
SMART Domains Protein: ENSMUSP00000051432
Gene: ENSMUSG00000049932

DomainStartEndE-ValueType
H2A 3 123 1.64e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054708
SMART Domains Protein: ENSMUSP00000056282
Gene: ENSMUSG00000032123

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
Pfam:Glycos_transf_4 100 272 1.1e-38 PFAM
transmembrane domain 277 299 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077353
AA Change: L232W

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126
AA Change: L232W

DomainStartEndE-ValueType
Pfam:Porphobil_deam 21 233 1.7e-79 PFAM
Pfam:Porphobil_deamC 244 323 6.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097558
AA Change: L215W

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126
AA Change: L215W

DomainStartEndE-ValueType
Pfam:Porphobil_deam 3 219 3.9e-95 PFAM
Pfam:Porphobil_deamC 227 327 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214967
Predicted Effect probably benign
Transcript: ENSMUST00000215050
Predicted Effect probably benign
Transcript: ENSMUST00000215091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215934
Predicted Effect unknown
Transcript: ENSMUST00000216658
AA Change: L48W
Predicted Effect probably benign
Transcript: ENSMUST00000216852
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for one null allele and a functional allele with a milder mutation exhibit typical features of acute intermittent porphyria with massive urinary excretion of aminolevulinic acid after phenobarbital treatment, erythruria, ataxia, motor dysfunction, and neurologic muscle atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Atf7ip G T 6: 136,606,867 V1299L probably damaging Het
Atp12a A T 14: 56,373,424 N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 G439D probably damaging Het
Bpifb2 G A 2: 153,889,510 D269N possibly damaging Het
Btd T G 14: 31,667,655 C444W probably damaging Het
Cacna1a A G 8: 84,601,946 D1624G probably benign Het
Carmil3 A C 14: 55,498,280 N563T probably damaging Het
Cars T C 7: 143,568,989 R538G probably benign Het
Catsperd A G 17: 56,654,525 K416E possibly damaging Het
Cc2d2a A T 5: 43,695,239 Y386F probably damaging Het
Ccpg1 A G 9: 72,999,478 N66S probably benign Het
Cd48 T A 1: 171,695,847 L86H probably damaging Het
Cdan1 A T 2: 120,729,575 H369Q probably damaging Het
Chil4 T C 3: 106,206,034 D189G probably benign Het
Cit T A 5: 115,873,900 Y189N possibly damaging Het
Cntn3 G A 6: 102,464,565 Q7* probably null Het
Csn1s2a A T 5: 87,775,799 I5F possibly damaging Het
Ctnnd1 C T 2: 84,605,179 probably null Het
Dmxl2 A T 9: 54,446,988 Y391* probably null Het
Dnah12 T C 14: 26,773,692 S1426P probably damaging Het
Dnhd1 T G 7: 105,693,660 S1404A possibly damaging Het
Drosha T A 15: 12,848,073 C484S probably benign Het
Dsg4 A T 18: 20,449,679 I125F probably damaging Het
Egfr T A 11: 16,869,301 M277K possibly damaging Het
Eml5 G T 12: 98,831,174 L1059I probably damaging Het
Erbb4 G T 1: 68,346,546 H295N probably benign Het
Etl4 T G 2: 20,743,874 V139G possibly damaging Het
Fam160a1 T A 3: 85,672,477 Y807F possibly damaging Het
Frem3 A T 8: 80,687,018 E1969D probably damaging Het
Gdf3 T A 6: 122,606,337 D357V probably damaging Het
Gimap8 T A 6: 48,647,529 probably null Het
Gml2 C A 15: 74,821,352 S68* probably null Het
Gphn A G 12: 78,504,629 I248V possibly damaging Het
Greb1 A T 12: 16,724,819 Y192* probably null Het
Iglon5 T A 7: 43,479,025 T123S probably benign Het
Ints2 C T 11: 86,226,781 R705H probably damaging Het
Ints8 A T 4: 11,245,842 L212Q probably damaging Het
Itgad A G 7: 128,198,121 Y846C probably benign Het
Kcnj1 A G 9: 32,396,492 T51A probably damaging Het
Kif1bp A G 10: 62,559,408 V485A probably damaging Het
Kif9 A T 9: 110,510,438 K449N possibly damaging Het
Klk11 G A 7: 43,778,909 W241* probably null Het
Krt32 T C 11: 100,084,110 probably null Het
Loxl1 A G 9: 58,293,640 F513S probably damaging Het
Mapk8ip3 A T 17: 24,904,923 S571T probably damaging Het
Mcam C T 9: 44,141,291 R606C probably damaging Het
Mtss1 T C 15: 58,951,672 N282S probably damaging Het
Myh13 T A 11: 67,353,674 D1012E probably benign Het
Myo16 A G 8: 10,502,817 T952A probably benign Het
Neb T C 2: 52,298,620 D874G probably damaging Het
Nek11 A G 9: 105,163,204 Y553H probably damaging Het
Nr2c2 T A 6: 92,105,331 V9D probably benign Het
Nxf1 T A 19: 8,762,436 F51L probably benign Het
Olfr1260 T C 2: 89,978,528 V250A probably damaging Het
Olfr1347 T C 7: 6,488,179 I232V probably damaging Het
Olfr1350 A G 7: 6,570,471 N160S probably damaging Het
Olfr170 A G 16: 19,606,312 S119P probably benign Het
Olfr344 A T 2: 36,568,873 I92F probably damaging Het
Olfr397 T G 11: 73,964,568 probably null Het
Olfr750 A G 14: 51,070,734 S220P probably damaging Het
Pcdhb8 A T 18: 37,356,519 N76Y probably damaging Het
Pdzrn4 T A 15: 92,399,804 F217I probably damaging Het
Ppp1r16a T A 15: 76,694,399 H434Q probably benign Het
Prpf19 T A 19: 10,901,022 F291I possibly damaging Het
R3hdm2 G T 10: 127,471,826 E319* probably null Het
Sel1l3 A G 5: 53,137,929 Y777H probably damaging Het
Serpinb5 G A 1: 106,870,289 A3T possibly damaging Het
Skp2 C A 15: 9,127,911 V88F probably damaging Het
Slc25a16 T C 10: 62,928,376 Y71H probably damaging Het
Slc6a6 T A 6: 91,740,992 I304N probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Sox17 C A 1: 4,491,928 G222C probably damaging Het
Trmu T A 15: 85,895,019 V289E possibly damaging Het
Vdac2 A G 14: 21,837,877 E96G probably damaging Het
Wdhd1 A T 14: 47,247,400 D885E probably benign Het
Zfp646 A G 7: 127,880,136 N495S probably damaging Het
Zfp663 T C 2: 165,352,653 T549A probably damaging Het
Zfp935 G A 13: 62,455,137 A83V possibly damaging Het
Other mutations in Hmbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Hmbs APN 9 44339548 missense possibly damaging 0.91
IGL02312:Hmbs APN 9 44341213 critical splice donor site probably null
R0386:Hmbs UTSW 9 44337008 missense probably benign 0.06
R0411:Hmbs UTSW 9 44341652 nonsense probably null
R0656:Hmbs UTSW 9 44337360 missense probably benign 0.31
R1560:Hmbs UTSW 9 44337360 missense possibly damaging 0.71
R1953:Hmbs UTSW 9 44337444 missense probably damaging 1.00
R2127:Hmbs UTSW 9 44340707 missense probably benign 0.09
R4637:Hmbs UTSW 9 44339537 missense probably damaging 1.00
R5549:Hmbs UTSW 9 44339477 critical splice donor site probably null
R6611:Hmbs UTSW 9 44341691 missense probably damaging 0.98
R7509:Hmbs UTSW 9 44336911 missense
R7702:Hmbs UTSW 9 44336850 splice site probably null
R8383:Hmbs UTSW 9 44337943 missense probably damaging 1.00
R8506:Hmbs UTSW 9 44341624 critical splice donor site probably null
R9069:Hmbs UTSW 9 44336805 missense possibly damaging 0.79
R9149:Hmbs UTSW 9 44341686 nonsense probably null
R9780:Hmbs UTSW 9 44336688 missense probably damaging 1.00
X0024:Hmbs UTSW 9 44337968 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATGGAAATGACAGTCCCTCCCCTC -3'
(R):5'- TGGTTCATAACCTTTGGCACCTGC -3'

Sequencing Primer
(F):5'- TTTTGACCACAGACCTCAAGGG -3'
(R):5'- GGCACCTGCTATCCATCAAATAAG -3'
Posted On 2014-04-13