Incidental Mutation 'R1503:Ccpg1'
ID 169461
Institutional Source Beutler Lab
Gene Symbol Ccpg1
Ensembl Gene ENSMUSG00000034563
Gene Name cell cycle progression 1
Synonyms 9430028F23Rik, 1810073J13Rik, 1700030B06Rik, D9Ertd392e
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 72892711-72923622 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72906760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 66 (N66S)
Ref Sequence ENSEMBL: ENSMUSP00000082458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037977] [ENSMUST00000085350] [ENSMUST00000124008] [ENSMUST00000140675] [ENSMUST00000149692] [ENSMUST00000150826] [ENSMUST00000156879]
AlphaFold Q640L3
Predicted Effect probably benign
Transcript: ENSMUST00000037977
AA Change: N66S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045669
Gene: ENSMUSG00000034563
AA Change: N66S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085350
AA Change: N66S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000082458
Gene: ENSMUSG00000034563
AA Change: N66S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124008
AA Change: N66S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121059
Gene: ENSMUSG00000034563
AA Change: N66S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140675
AA Change: N66S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116976
Gene: ENSMUSG00000034563
AA Change: N66S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149551
Predicted Effect probably benign
Transcript: ENSMUST00000149692
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150826
AA Change: N66S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122966
Gene: ENSMUSG00000034563
AA Change: N66S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
coiled coil region 296 450 N/A INTRINSIC
low complexity region 566 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156879
AA Change: N66S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117202
Gene: ENSMUSG00000034563
AA Change: N66S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Ccpg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Ccpg1 APN 9 72,913,159 (GRCm39) missense probably damaging 1.00
IGL01710:Ccpg1 APN 9 72,904,723 (GRCm39) utr 3 prime probably benign
IGL01818:Ccpg1 APN 9 72,904,735 (GRCm39) missense probably damaging 1.00
K7894:Ccpg1 UTSW 9 72,909,159 (GRCm39) critical splice donor site probably null
R0586:Ccpg1 UTSW 9 72,909,103 (GRCm39) missense probably benign 0.00
R1188:Ccpg1 UTSW 9 72,919,788 (GRCm39) missense possibly damaging 0.55
R1599:Ccpg1 UTSW 9 72,906,407 (GRCm39) nonsense probably null
R2130:Ccpg1 UTSW 9 72,920,440 (GRCm39) missense probably damaging 0.98
R2188:Ccpg1 UTSW 9 72,920,388 (GRCm39) missense probably benign 0.00
R3052:Ccpg1 UTSW 9 72,913,150 (GRCm39) missense probably damaging 1.00
R4155:Ccpg1 UTSW 9 72,919,449 (GRCm39) missense probably benign 0.38
R4156:Ccpg1 UTSW 9 72,919,449 (GRCm39) missense probably benign 0.38
R4157:Ccpg1 UTSW 9 72,919,449 (GRCm39) missense probably benign 0.38
R4257:Ccpg1 UTSW 9 72,919,909 (GRCm39) missense probably damaging 1.00
R4677:Ccpg1 UTSW 9 72,923,197 (GRCm39) intron probably benign
R5081:Ccpg1 UTSW 9 72,906,360 (GRCm39) missense possibly damaging 0.94
R5227:Ccpg1 UTSW 9 72,919,354 (GRCm39) nonsense probably null
R5288:Ccpg1 UTSW 9 72,920,326 (GRCm39) missense probably benign
R5385:Ccpg1 UTSW 9 72,920,326 (GRCm39) missense probably benign
R5386:Ccpg1 UTSW 9 72,920,326 (GRCm39) missense probably benign
R5412:Ccpg1 UTSW 9 72,917,588 (GRCm39) missense probably damaging 1.00
R5754:Ccpg1 UTSW 9 72,920,526 (GRCm39) missense possibly damaging 0.78
R6230:Ccpg1 UTSW 9 72,919,638 (GRCm39) missense probably benign 0.00
R7269:Ccpg1 UTSW 9 72,920,609 (GRCm39) missense probably benign 0.06
R7287:Ccpg1 UTSW 9 72,922,688 (GRCm39) missense probably benign 0.05
R7542:Ccpg1 UTSW 9 72,919,741 (GRCm39) missense probably damaging 1.00
R7882:Ccpg1 UTSW 9 72,922,787 (GRCm39) missense probably damaging 1.00
R8266:Ccpg1 UTSW 9 72,913,001 (GRCm39) missense probably damaging 1.00
R8268:Ccpg1 UTSW 9 72,913,001 (GRCm39) missense probably damaging 1.00
R8269:Ccpg1 UTSW 9 72,913,001 (GRCm39) missense probably damaging 1.00
R8345:Ccpg1 UTSW 9 72,913,001 (GRCm39) missense probably damaging 1.00
R8829:Ccpg1 UTSW 9 72,917,633 (GRCm39) missense probably benign 0.00
R9450:Ccpg1 UTSW 9 72,904,703 (GRCm39) missense unknown
R9648:Ccpg1 UTSW 9 72,919,312 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGCCTGTAATGAGTCACATTCCC -3'
(R):5'- CTTGCTTAGAGTCCTGTTCTGAAACCC -3'

Sequencing Primer
(F):5'- GAGTCACATTCCCTGTGTGAAATTG -3'
(R):5'- GAGTCCTGTTCTGAAACCCAAAAAAG -3'
Posted On 2014-04-13