Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Slc25a16'

169466

Institutional Source

Beutler Lab

Gene Symbol

Slc25a16

Ensembl Gene

ENSMUSG00000071253

Gene Name

solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16

Synonyms

HGT.1, ML7, 3110021G18Rik

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62920633-62946498 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62928376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 71 (Y71H)

Ref Sequence

ENSEMBL: ENSMUSP00000114510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044977] [ENSMUST00000144459]

AlphaFold

Q8C0K5

Predicted Effect

probably damaging
Transcript: ENSMUST00000044977
AA Change: Y71H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043370
Gene: ENSMUSG00000071253
AA Change: Y71H

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
Pfam:Mito_carr	32	125	1.7e-25	PFAM
Pfam:Mito_carr	127	220	2.3e-26	PFAM
Pfam:Mito_carr	237	332	8.6e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138597

Predicted Effect

probably damaging
Transcript: ENSMUST00000144459
AA Change: Y71H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114510
Gene: ENSMUSG00000071253
AA Change: Y71H

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
Pfam:Mito_carr	32	125	9.4e-28	PFAM
Pfam:Mito_carr	126	223	4.6e-25	PFAM
Pfam:Mito_carr	240	322	2.3e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158250

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains three tandemly repeated mitochondrial carrier protein domains. The encoded protein is localized in the inner membrane and facilitates the rapid transport and exchange of molecules between the cytosol and the mitochondrial matrix space. This gene has a possible role in Graves' disease. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Slc25a16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Slc25a16	APN	10	62944433	splice site	probably null
IGL01963:Slc25a16	APN	10	62930441	splice site	probably null
IGL02130:Slc25a16	APN	10	62944358	missense	probably benign	0.02
R1533:Slc25a16	UTSW	10	62920864	missense	probably damaging	0.97
R2067:Slc25a16	UTSW	10	62932751	missense	probably benign	0.25
R4388:Slc25a16	UTSW	10	62928326	missense	probably benign	0.18
R6225:Slc25a16	UTSW	10	62928323	missense	probably damaging	1.00
R6457:Slc25a16	UTSW	10	62941159	missense	probably benign	0.20
R6459:Slc25a16	UTSW	10	62937477	nonsense	probably null
R7009:Slc25a16	UTSW	10	62937454	missense	possibly damaging	0.95
R7814:Slc25a16	UTSW	10	62937420	missense	probably benign	0.00
R8792:Slc25a16	UTSW	10	62928340	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGACCCGTGATGATTTCCCTTTG -3'
(R):5'- attgagAACTGGCCCCtgttggtg -3'

Sequencing Primer
(F):5'- CCCTTTGGGAGGAGGTGC -3'
(R):5'- gcacaccacctctaatccc -3'

Posted On

2014-04-13