Incidental Mutation 'R1503:Krt32'
ID 169471
Institutional Source Beutler Lab
Gene Symbol Krt32
Ensembl Gene ENSMUSG00000046095
Gene Name keratin 32
Synonyms mHa2, Krt1-2
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R1503 (G1)
Quality Score 223
Status Not validated
Chromosome 11
Chromosomal Location 99971674-99979095 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 99974936 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107419] [ENSMUST00000107419]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000107419
SMART Domains Protein: ENSMUSP00000103042
Gene: ENSMUSG00000046095

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Filament 100 411 5.4e-150 SMART
low complexity region 435 448 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107419
SMART Domains Protein: ENSMUSP00000103042
Gene: ENSMUSG00000046095

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Filament 100 411 5.4e-150 SMART
low complexity region 435 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139873
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Krt32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Krt32 APN 11 99,978,605 (GRCm39) missense probably benign 0.23
IGL01454:Krt32 APN 11 99,974,907 (GRCm39) missense probably damaging 1.00
IGL02268:Krt32 APN 11 99,978,967 (GRCm39) missense probably benign 0.21
IGL02502:Krt32 APN 11 99,978,749 (GRCm39) missense probably damaging 1.00
IGL02967:Krt32 APN 11 99,974,876 (GRCm39) missense possibly damaging 0.93
IGL02799:Krt32 UTSW 11 99,978,733 (GRCm39) missense possibly damaging 0.54
R0840:Krt32 UTSW 11 99,972,068 (GRCm39) missense probably benign 0.00
R1944:Krt32 UTSW 11 99,975,670 (GRCm39) critical splice acceptor site probably null
R1945:Krt32 UTSW 11 99,975,670 (GRCm39) critical splice acceptor site probably null
R2426:Krt32 UTSW 11 99,977,192 (GRCm39) missense possibly damaging 0.76
R3774:Krt32 UTSW 11 99,978,947 (GRCm39) missense probably benign 0.00
R3775:Krt32 UTSW 11 99,978,947 (GRCm39) missense probably benign 0.00
R3776:Krt32 UTSW 11 99,978,947 (GRCm39) missense probably benign 0.00
R5522:Krt32 UTSW 11 99,977,497 (GRCm39) critical splice donor site probably null
R5794:Krt32 UTSW 11 99,975,812 (GRCm39) missense probably damaging 0.99
R6109:Krt32 UTSW 11 99,978,791 (GRCm39) missense probably benign 0.01
R6994:Krt32 UTSW 11 99,977,271 (GRCm39) missense probably damaging 1.00
R7375:Krt32 UTSW 11 99,972,050 (GRCm39) missense probably benign 0.18
R7577:Krt32 UTSW 11 99,972,047 (GRCm39) missense probably benign 0.00
R8249:Krt32 UTSW 11 99,977,548 (GRCm39) missense probably benign 0.00
R9207:Krt32 UTSW 11 99,977,580 (GRCm39) missense possibly damaging 0.61
R9303:Krt32 UTSW 11 99,972,029 (GRCm39) missense probably benign 0.00
R9305:Krt32 UTSW 11 99,972,029 (GRCm39) missense probably benign 0.00
R9684:Krt32 UTSW 11 99,977,308 (GRCm39) missense probably damaging 1.00
Z1088:Krt32 UTSW 11 99,979,042 (GRCm39) missense probably benign
Z1177:Krt32 UTSW 11 99,974,895 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGACATCCAGCAACACCTTGTACTC -3'
(R):5'- GATATCTACTTGGCCTGACTTTCCGAC -3'

Sequencing Primer
(F):5'- GCAACACCTTGTACTCTTGGTTC -3'
(R):5'- ccaacctgtgtgttcaaactc -3'
Posted On 2014-04-13