Incidental Mutation 'R1503:Gphn'
ID 169475
Institutional Source Beutler Lab
Gene Symbol Gphn
Ensembl Gene ENSMUSG00000047454
Gene Name gephyrin
Synonyms 5730552E08Rik, geph
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 78273153-78731546 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78551403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 248 (I248V)
Ref Sequence ENSEMBL: ENSMUSP00000054064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]
AlphaFold Q8BUV3
Predicted Effect possibly damaging
Transcript: ENSMUST00000052472
AA Change: I248V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454
AA Change: I248V

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 356 522 5.6e-53 PFAM
MoCF_biosynth 535 678 8.1e-38 SMART
Pfam:MoeA_C 691 766 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110388
AA Change: I284V

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454
AA Change: I284V

DomainStartEndE-ValueType
MoCF_biosynth 18 165 4.52e-27 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:MoeA_N 360 525 2.1e-35 PFAM
MoCF_biosynth 538 681 8.1e-38 SMART
Pfam:MoeA_C 694 769 8.1e-26 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Gphn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gphn APN 12 78,551,406 (GRCm39) missense probably damaging 1.00
IGL00701:Gphn APN 12 78,672,941 (GRCm39) missense possibly damaging 0.93
IGL00844:Gphn APN 12 78,711,342 (GRCm39) splice site probably benign
IGL01517:Gphn APN 12 78,423,148 (GRCm39) missense probably damaging 1.00
IGL02499:Gphn APN 12 78,539,074 (GRCm39) missense probably benign 0.17
IGL02827:Gphn APN 12 78,655,994 (GRCm39) missense probably damaging 1.00
IGL03136:Gphn APN 12 78,528,107 (GRCm39) missense possibly damaging 0.69
IGL03348:Gphn APN 12 78,673,893 (GRCm39) missense probably damaging 0.99
IGL03382:Gphn APN 12 78,528,087 (GRCm39) missense probably damaging 1.00
grizzlies UTSW 12 78,701,654 (GRCm39) missense probably benign 0.28
3-1:Gphn UTSW 12 78,659,775 (GRCm39) missense probably benign 0.06
R0054:Gphn UTSW 12 78,684,277 (GRCm39) missense probably damaging 1.00
R0054:Gphn UTSW 12 78,684,277 (GRCm39) missense probably damaging 1.00
R0212:Gphn UTSW 12 78,684,326 (GRCm39) missense probably damaging 0.99
R0389:Gphn UTSW 12 78,637,433 (GRCm39) missense probably damaging 1.00
R0535:Gphn UTSW 12 78,538,824 (GRCm39) missense possibly damaging 0.90
R1464:Gphn UTSW 12 78,659,738 (GRCm39) splice site probably benign
R1606:Gphn UTSW 12 78,730,657 (GRCm39) missense probably damaging 1.00
R1896:Gphn UTSW 12 78,459,128 (GRCm39) missense possibly damaging 0.74
R2248:Gphn UTSW 12 78,501,595 (GRCm39) missense probably damaging 1.00
R3708:Gphn UTSW 12 78,579,467 (GRCm39) missense probably benign
R3907:Gphn UTSW 12 78,540,716 (GRCm39) splice site probably benign
R4537:Gphn UTSW 12 78,540,788 (GRCm39) missense probably benign 0.03
R4667:Gphn UTSW 12 78,501,591 (GRCm39) missense probably damaging 1.00
R4808:Gphn UTSW 12 78,701,654 (GRCm39) missense probably benign 0.28
R4840:Gphn UTSW 12 78,569,729 (GRCm39) critical splice donor site probably null
R4852:Gphn UTSW 12 78,673,984 (GRCm39) missense probably damaging 1.00
R4854:Gphn UTSW 12 78,673,984 (GRCm39) missense probably damaging 1.00
R4855:Gphn UTSW 12 78,673,984 (GRCm39) missense probably damaging 1.00
R5083:Gphn UTSW 12 78,670,063 (GRCm39) splice site probably null
R5224:Gphn UTSW 12 78,637,361 (GRCm39) missense probably damaging 0.99
R5580:Gphn UTSW 12 78,538,818 (GRCm39) missense probably damaging 1.00
R5626:Gphn UTSW 12 78,730,671 (GRCm39) missense probably benign 0.11
R6270:Gphn UTSW 12 78,569,724 (GRCm39) missense probably benign
R6563:Gphn UTSW 12 78,727,170 (GRCm39) critical splice donor site probably null
R6943:Gphn UTSW 12 78,538,955 (GRCm39) missense possibly damaging 0.88
R6958:Gphn UTSW 12 78,727,073 (GRCm39) missense possibly damaging 0.86
R7170:Gphn UTSW 12 78,730,663 (GRCm39) missense possibly damaging 0.67
R7295:Gphn UTSW 12 78,538,876 (GRCm39) missense probably benign 0.02
R7514:Gphn UTSW 12 78,672,939 (GRCm39) missense probably damaging 0.97
R7537:Gphn UTSW 12 78,551,454 (GRCm39) missense possibly damaging 0.62
R7680:Gphn UTSW 12 78,459,148 (GRCm39) missense probably benign 0.14
R8236:Gphn UTSW 12 78,711,311 (GRCm39) missense probably damaging 1.00
R8377:Gphn UTSW 12 78,711,280 (GRCm39) missense probably damaging 1.00
R8409:Gphn UTSW 12 78,659,784 (GRCm39) missense probably damaging 1.00
R8468:Gphn UTSW 12 78,273,601 (GRCm39) missense probably benign 0.22
R8742:Gphn UTSW 12 78,659,766 (GRCm39) missense probably damaging 1.00
R8832:Gphn UTSW 12 78,459,174 (GRCm39) synonymous silent
R8845:Gphn UTSW 12 78,538,953 (GRCm39) missense probably benign 0.30
R8972:Gphn UTSW 12 78,656,013 (GRCm39) critical splice donor site probably null
R9254:Gphn UTSW 12 78,674,036 (GRCm39) critical splice donor site probably null
R9287:Gphn UTSW 12 78,609,646 (GRCm39) missense possibly damaging 0.68
R9355:Gphn UTSW 12 78,538,968 (GRCm39) missense probably damaging 0.97
R9536:Gphn UTSW 12 78,609,636 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ATGCATGTCCTCCTAACCACGC -3'
(R):5'- TCCAACCTTGACAAGCTGGGAAAAC -3'

Sequencing Primer
(F):5'- TAACCACGCTTGAGGTCTAC -3'
(R):5'- CTTGACAAGCTGGGAAAACATTTG -3'
Posted On 2014-04-13