Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Gphn'

169475

Institutional Source

Beutler Lab

Gene Symbol

Gphn

Ensembl Gene

ENSMUSG00000047454

Gene Name

gephyrin

Synonyms

5730552E08Rik, geph

MMRRC Submission

039553-MU

Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78226379-78684772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78504629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 248 (I248V)

Ref Sequence

ENSEMBL: ENSMUSP00000054064 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000110388]

AlphaFold

Q8BUV3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052472
AA Change: I248V

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454
AA Change: I248V

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	356	522	5.6e-53	PFAM
MoCF_biosynth	535	678	8.1e-38	SMART
Pfam:MoeA_C	691	766	8.9e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110388
AA Change: I284V

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454
AA Change: I284V

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	360	525	2.1e-35	PFAM
MoCF_biosynth	538	681	8.1e-38	SMART
Pfam:MoeA_C	694	769	8.1e-26	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Gphn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Gphn	APN	12	78504632	missense	probably damaging	1.00
IGL00701:Gphn	APN	12	78626167	missense	possibly damaging	0.93
IGL00844:Gphn	APN	12	78664568	splice site	probably benign
IGL01517:Gphn	APN	12	78376374	missense	probably damaging	1.00
IGL02499:Gphn	APN	12	78492300	missense	probably benign	0.17
IGL02827:Gphn	APN	12	78609220	missense	probably damaging	1.00
IGL03136:Gphn	APN	12	78481333	missense	possibly damaging	0.69
IGL03348:Gphn	APN	12	78627119	missense	probably damaging	0.99
IGL03382:Gphn	APN	12	78481313	missense	probably damaging	1.00
grizzlies	UTSW	12	78654880	missense	probably benign	0.28
3-1:Gphn	UTSW	12	78613001	missense	probably benign	0.06
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0212:Gphn	UTSW	12	78637552	missense	probably damaging	0.99
R0389:Gphn	UTSW	12	78590659	missense	probably damaging	1.00
R0535:Gphn	UTSW	12	78492050	missense	possibly damaging	0.90
R1464:Gphn	UTSW	12	78612964	splice site	probably benign
R1606:Gphn	UTSW	12	78683883	missense	probably damaging	1.00
R1896:Gphn	UTSW	12	78412354	missense	possibly damaging	0.74
R2248:Gphn	UTSW	12	78454821	missense	probably damaging	1.00
R3708:Gphn	UTSW	12	78532693	missense	probably benign
R3907:Gphn	UTSW	12	78493942	splice site	probably benign
R4537:Gphn	UTSW	12	78494014	missense	probably benign	0.03
R4667:Gphn	UTSW	12	78454817	missense	probably damaging	1.00
R4808:Gphn	UTSW	12	78654880	missense	probably benign	0.28
R4840:Gphn	UTSW	12	78522955	critical splice donor site	probably null
R4852:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R4854:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R4855:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R5083:Gphn	UTSW	12	78623289	splice site	probably null
R5224:Gphn	UTSW	12	78590587	missense	probably damaging	0.99
R5580:Gphn	UTSW	12	78492044	missense	probably damaging	1.00
R5626:Gphn	UTSW	12	78683897	missense	probably benign	0.11
R6270:Gphn	UTSW	12	78522950	missense	probably benign
R6563:Gphn	UTSW	12	78680396	critical splice donor site	probably null
R6943:Gphn	UTSW	12	78492181	missense	possibly damaging	0.88
R6958:Gphn	UTSW	12	78680299	missense	possibly damaging	0.86
R7170:Gphn	UTSW	12	78683889	missense	possibly damaging	0.67
R7295:Gphn	UTSW	12	78492102	missense	probably benign	0.02
R7514:Gphn	UTSW	12	78626165	missense	probably damaging	0.97
R7537:Gphn	UTSW	12	78504680	missense	possibly damaging	0.62
R7680:Gphn	UTSW	12	78412374	missense	probably benign	0.14
R8236:Gphn	UTSW	12	78664537	missense	probably damaging	1.00
R8377:Gphn	UTSW	12	78664506	missense	probably damaging	1.00
R8409:Gphn	UTSW	12	78613010	missense	probably damaging	1.00
R8468:Gphn	UTSW	12	78226827	missense	probably benign	0.22
R8742:Gphn	UTSW	12	78612992	missense	probably damaging	1.00
R8832:Gphn	UTSW	12	78412400	synonymous	silent
R8845:Gphn	UTSW	12	78492179	missense	probably benign	0.30
R8972:Gphn	UTSW	12	78609239	critical splice donor site	probably null
R9254:Gphn	UTSW	12	78627262	critical splice donor site	probably null
R9287:Gphn	UTSW	12	78562872	missense	possibly damaging	0.68
R9355:Gphn	UTSW	12	78492194	missense	probably damaging	0.97
R9536:Gphn	UTSW	12	78562862	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- ATGCATGTCCTCCTAACCACGC -3'
(R):5'- TCCAACCTTGACAAGCTGGGAAAAC -3'

Sequencing Primer
(F):5'- TAACCACGCTTGAGGTCTAC -3'
(R):5'- CTTGACAAGCTGGGAAAACATTTG -3'

Posted On

2014-04-13