Incidental Mutation 'R1503:Vdac2'
ID 169479
Institutional Source Beutler Lab
Gene Symbol Vdac2
Ensembl Gene ENSMUSG00000021771
Gene Name voltage-dependent anion channel 2
Synonyms Vdac6
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.433) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 21881629-21895947 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21887945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000152916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022293] [ENSMUST00000152562] [ENSMUST00000153320] [ENSMUST00000172727] [ENSMUST00000173456] [ENSMUST00000224373]
AlphaFold Q60930
Predicted Effect possibly damaging
Transcript: ENSMUST00000022293
AA Change: E96G

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022293
Gene: ENSMUSG00000021771
AA Change: E96G

DomainStartEndE-ValueType
Pfam:Porin_3 15 288 4.5e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147715
Predicted Effect probably benign
Transcript: ENSMUST00000152562
SMART Domains Protein: ENSMUSP00000123032
Gene: ENSMUSG00000021771

DomainStartEndE-ValueType
Pfam:Porin_3 15 75 1.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153320
AA Change: E96G

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115560
Gene: ENSMUSG00000021771
AA Change: E96G

DomainStartEndE-ValueType
Pfam:Porin_3 15 201 1.6e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172727
AA Change: E84G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133525
Gene: ENSMUSG00000021771
AA Change: E84G

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 6.4e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173456
AA Change: E84G

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134023
Gene: ENSMUSG00000021771
AA Change: E84G

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 6.4e-80 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224373
AA Change: E96G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-dependent anion channel pore-forming family of proteins that are considered the main pathway for metabolite diffusion across the mitochondrial outer membrane. The encoded protein is also thought to be involved in the mitochondrial apoptotic pathway via regulation of BCL2-antagonist/killer 1 protein activity. Pseudogenes have been identified on chromosomes 1, 2, 12 and 21, and alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Vdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Vdac2 APN 14 21,888,592 (GRCm39) missense possibly damaging 0.53
IGL00536:Vdac2 APN 14 21,888,511 (GRCm39) missense probably benign 0.06
IGL02828:Vdac2 APN 14 21,893,957 (GRCm39) missense probably benign 0.11
R1171:Vdac2 UTSW 14 21,887,879 (GRCm39) missense probably damaging 1.00
R1952:Vdac2 UTSW 14 21,887,947 (GRCm39) missense possibly damaging 0.71
R6221:Vdac2 UTSW 14 21,895,246 (GRCm39) missense possibly damaging 0.94
R6223:Vdac2 UTSW 14 21,895,246 (GRCm39) missense possibly damaging 0.94
R8491:Vdac2 UTSW 14 21,887,838 (GRCm39) missense possibly damaging 0.54
R9288:Vdac2 UTSW 14 21,881,962 (GRCm39) missense probably benign
Z1177:Vdac2 UTSW 14 21,881,969 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTAAGGGACATTCTGGTGGCAGTC -3'
(R):5'- ACCCTGTGTTCGGTGAAAAGGTG -3'

Sequencing Primer
(F):5'- GGCAGTCACTTGGTCAGAG -3'
(R):5'- GGTGTCAAAAGTCAGTTTCAAACC -3'
Posted On 2014-04-13