Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Wdhd1'

169482

Institutional Source

Beutler Lab

Gene Symbol

Wdhd1

Ensembl Gene

ENSMUSG00000037572

Gene Name

WD repeat and HMG-box DNA binding protein 1

Synonyms

AND-1, D630024B06Rik

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47240944-47276857 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47247400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 885 (D885E)

Ref Sequence

ENSEMBL: ENSMUSP00000141182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531] [ENSMUST00000227041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000111791
AA Change: D885E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: D885E

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:Mcl1_mid	424	708	1.6e-103	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111792
AA Change: D848E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: D848E

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	316	326	N/A	INTRINSIC
Pfam:DUF3639	488	514	7.1e-13	PFAM
coiled coil region	765	797	N/A	INTRINSIC
HMG	966	1036	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187531
AA Change: D885E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: D885E

Domain	Start	End	E-Value	Type
WD40	4	41	8.62e-4	SMART
WD40	83	122	8.91e-1	SMART
WD40	125	164	1.67e-10	SMART
WD40	217	258	6.19e-1	SMART
WD40	261	301	5.11e1	SMART
low complexity region	353	363	N/A	INTRINSIC
Pfam:DUF3639	525	551	3e-13	PFAM
coiled coil region	802	834	N/A	INTRINSIC
HMG	1003	1073	2.64e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228810

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Wdhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Wdhd1	APN	14	47250782	missense	possibly damaging	0.87
IGL01789:Wdhd1	APN	14	47274817	missense	probably benign	0.10
IGL01981:Wdhd1	APN	14	47261450	missense	probably damaging	1.00
IGL02034:Wdhd1	APN	14	47261351	missense	probably benign	0.02
IGL02932:Wdhd1	APN	14	47272134	critical splice donor site	probably null
IGL02966:Wdhd1	APN	14	47241644	missense	possibly damaging	0.93
IGL03355:Wdhd1	APN	14	47243889	missense	possibly damaging	0.78
R0165:Wdhd1	UTSW	14	47267068	missense	probably benign	0.00
R0414:Wdhd1	UTSW	14	47276588	missense	probably benign
R0603:Wdhd1	UTSW	14	47263586	missense	probably damaging	1.00
R1539:Wdhd1	UTSW	14	47245050	missense	possibly damaging	0.63
R1541:Wdhd1	UTSW	14	47268192	nonsense	probably null
R1588:Wdhd1	UTSW	14	47256236	missense	probably damaging	1.00
R1686:Wdhd1	UTSW	14	47256215	missense	probably damaging	1.00
R1916:Wdhd1	UTSW	14	47258577	missense	possibly damaging	0.89
R1952:Wdhd1	UTSW	14	47270190	missense	probably damaging	1.00
R2320:Wdhd1	UTSW	14	47274028	missense	probably benign	0.06
R2421:Wdhd1	UTSW	14	47258584	missense	probably benign	0.00
R3731:Wdhd1	UTSW	14	47247892	missense	possibly damaging	0.89
R3818:Wdhd1	UTSW	14	47243801	critical splice donor site	probably null
R3836:Wdhd1	UTSW	14	47245054	missense	probably benign	0.01
R4789:Wdhd1	UTSW	14	47268692	missense	probably benign	0.01
R4963:Wdhd1	UTSW	14	47268689	missense	possibly damaging	0.66
R4994:Wdhd1	UTSW	14	47268654	critical splice donor site	probably null
R5225:Wdhd1	UTSW	14	47250816	missense	probably benign	0.01
R5347:Wdhd1	UTSW	14	47268724	nonsense	probably null
R5377:Wdhd1	UTSW	14	47272221	missense	probably benign	0.15
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6038:Wdhd1	UTSW	14	47263580	missense	possibly damaging	0.89
R6046:Wdhd1	UTSW	14	47273210	nonsense	probably null
R6156:Wdhd1	UTSW	14	47268196	missense	probably damaging	0.99
R6289:Wdhd1	UTSW	14	47258496	missense	possibly damaging	0.95
R6298:Wdhd1	UTSW	14	47273122	missense	possibly damaging	0.67
R6345:Wdhd1	UTSW	14	47251922	missense	probably damaging	0.99
R6405:Wdhd1	UTSW	14	47243867	missense	possibly damaging	0.91
R6500:Wdhd1	UTSW	14	47250760	splice site	probably null
R6564:Wdhd1	UTSW	14	47248042	missense	probably benign
R6897:Wdhd1	UTSW	14	47248130	missense	probably damaging	1.00
R7262:Wdhd1	UTSW	14	47251973	missense	probably benign	0.08
R7444:Wdhd1	UTSW	14	47251948	nonsense	probably null
R7496:Wdhd1	UTSW	14	47274024	missense	probably benign	0.39
R7503:Wdhd1	UTSW	14	47250791	missense	probably benign	0.25
R8317:Wdhd1	UTSW	14	47263537	missense	probably damaging	1.00
R8323:Wdhd1	UTSW	14	47274795	missense	possibly damaging	0.85
R8331:Wdhd1	UTSW	14	47272245	splice site	probably null
R8338:Wdhd1	UTSW	14	47268663	missense	probably benign
R8363:Wdhd1	UTSW	14	47276532	missense	probably damaging	1.00
R8944:Wdhd1	UTSW	14	47267013	missense	probably benign
R8946:Wdhd1	UTSW	14	47245295	missense	probably benign	0.01
R9045:Wdhd1	UTSW	14	47273952	missense	probably benign	0.01
R9428:Wdhd1	UTSW	14	47251970	nonsense	probably null
R9444:Wdhd1	UTSW	14	47250867	missense	possibly damaging	0.85
R9491:Wdhd1	UTSW	14	47268159	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTTAGAACCTACAGCAGCCTCC -3'
(R):5'- CCACGGGTCAGAAGTCAAGTTGAAG -3'

Sequencing Primer
(F):5'- CCTCCCAGGGATCTTAGAATG -3'
(R):5'- tcaccgacagaacacacc -3'

Posted On

2014-04-13