Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Atp12a'

169485

Institutional Source

Beutler Lab

Gene Symbol

Atp12a

Ensembl Gene

ENSMUSG00000022229

Gene Name

ATPase, H+/K+ transporting, nongastric, alpha polypeptide

Synonyms

cHKA, ATPase H+K+-transporting, alpha 2, Atp1al1, HKalpha2

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56365068-56388550 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56373424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 342 (N342Y)

Ref Sequence

ENSEMBL: ENSMUSP00000007340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007340]

AlphaFold

Q9Z1W8

Predicted Effect

probably damaging
Transcript: ENSMUST00000007340
AA Change: N342Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000007340
Gene: ENSMUSG00000022229
AA Change: N342Y

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
Cation_ATPase_N	54	128	9.27e-15	SMART
Pfam:E1-E2_ATPase	145	376	9.8e-57	PFAM
Pfam:Hydrolase	381	740	7.8e-20	PFAM
Pfam:HAD	384	737	7.6e-19	PFAM
Pfam:Cation_ATPase	437	532	3.4e-26	PFAM
Pfam:Cation_ATPase_C	810	1020	9.9e-44	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225567

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225698

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This gene encodes a catalytic subunit of the ouabain-sensitive H+/K+ -ATPase that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for potassium absorption in various tissues. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased potassium excretion. When placed on a potassium-free diet, mutant animals display greater weight loss and slightly increased kidney weight compared to wild-type. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Atp12a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Atp12a	APN	14	56379955	missense	probably damaging	1.00
IGL02108:Atp12a	APN	14	56384068	missense	possibly damaging	0.95
IGL02176:Atp12a	APN	14	56387179	missense	probably damaging	1.00
IGL02210:Atp12a	APN	14	56371744	nonsense	probably null
IGL02828:Atp12a	APN	14	56376142	missense	possibly damaging	0.72
IGL02868:Atp12a	APN	14	56384182	missense	probably damaging	1.00
IGL02876:Atp12a	APN	14	56373289	missense	probably benign	0.00
R0045:Atp12a	UTSW	14	56372873	missense	probably damaging	1.00
R0172:Atp12a	UTSW	14	56372844	missense	probably damaging	1.00
R0276:Atp12a	UTSW	14	56387694	missense	probably damaging	1.00
R0613:Atp12a	UTSW	14	56374521	missense	probably damaging	1.00
R0656:Atp12a	UTSW	14	56374481	missense	probably damaging	1.00
R0962:Atp12a	UTSW	14	56368413	missense	probably damaging	1.00
R1067:Atp12a	UTSW	14	56373436	missense	probably damaging	1.00
R1448:Atp12a	UTSW	14	56385839	missense	probably damaging	1.00
R1590:Atp12a	UTSW	14	56380055	missense	probably damaging	1.00
R1639:Atp12a	UTSW	14	56384068	missense	possibly damaging	0.95
R1660:Atp12a	UTSW	14	56370848	missense	probably benign	0.21
R1696:Atp12a	UTSW	14	56366088	missense	probably damaging	1.00
R1775:Atp12a	UTSW	14	56372589	missense	probably benign	0.23
R1920:Atp12a	UTSW	14	56386851	missense	probably benign	0.19
R2022:Atp12a	UTSW	14	56365282	start codon destroyed	probably null
R2071:Atp12a	UTSW	14	56366009	missense	probably benign
R2253:Atp12a	UTSW	14	56376258	missense	probably benign	0.03
R2289:Atp12a	UTSW	14	56373262	missense	possibly damaging	0.93
R2567:Atp12a	UTSW	14	56386927	missense	probably damaging	1.00
R2870:Atp12a	UTSW	14	56386950	missense	possibly damaging	0.94
R2870:Atp12a	UTSW	14	56386950	missense	possibly damaging	0.94
R2872:Atp12a	UTSW	14	56386950	missense	possibly damaging	0.94
R2872:Atp12a	UTSW	14	56386950	missense	possibly damaging	0.94
R2873:Atp12a	UTSW	14	56386950	missense	possibly damaging	0.94
R2923:Atp12a	UTSW	14	56374622	missense	probably benign
R3736:Atp12a	UTSW	14	56374427	missense	possibly damaging	0.90
R3754:Atp12a	UTSW	14	56372588	missense	probably benign	0.01
R5028:Atp12a	UTSW	14	56386978	missense	probably damaging	0.96
R5267:Atp12a	UTSW	14	56384211	missense	probably damaging	1.00
R5481:Atp12a	UTSW	14	56373389	missense	possibly damaging	0.90
R5590:Atp12a	UTSW	14	56373380	missense	probably benign	0.11
R5842:Atp12a	UTSW	14	56378290	missense	probably damaging	0.96
R5899:Atp12a	UTSW	14	56373344	missense	probably benign	0.44
R5985:Atp12a	UTSW	14	56384341	missense	probably damaging	1.00
R6044:Atp12a	UTSW	14	56376155	missense	probably damaging	1.00
R6271:Atp12a	UTSW	14	56378422	missense	probably benign	0.00
R6454:Atp12a	UTSW	14	56370833	missense	probably benign	0.02
R6461:Atp12a	UTSW	14	56373238	missense	probably damaging	1.00
R6610:Atp12a	UTSW	14	56374556	missense	probably damaging	1.00
R6666:Atp12a	UTSW	14	56373364	missense	probably benign	0.36
R6667:Atp12a	UTSW	14	56384188	missense	possibly damaging	0.82
R6677:Atp12a	UTSW	14	56380854	missense	probably damaging	1.00
R6791:Atp12a	UTSW	14	56386982	critical splice donor site	probably null
R7003:Atp12a	UTSW	14	56373380	missense	possibly damaging	0.87
R7173:Atp12a	UTSW	14	56384380	missense	probably damaging	1.00
R7523:Atp12a	UTSW	14	56365968	missense	possibly damaging	0.85
R8063:Atp12a	UTSW	14	56366088	missense	probably damaging	1.00
R8376:Atp12a	UTSW	14	56374626	critical splice donor site	probably null
R8670:Atp12a	UTSW	14	56380089	missense	probably damaging	1.00
X0004:Atp12a	UTSW	14	56378467	missense	probably benign	0.16
Z1088:Atp12a	UTSW	14	56386141	missense	probably benign	0.19
Z1176:Atp12a	UTSW	14	56372706	missense	probably damaging	1.00
Z1177:Atp12a	UTSW	14	56373215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTTCTATTCTACAACGTGCCTGG -3'
(R):5'- AAACAGGCCCATAGTGGTCTCTGG -3'

Sequencing Primer
(F):5'- TGGCATTGTCATCAACACGG -3'
(R):5'- TCTGGAGGGGACAGTGTG -3'

Posted On

2014-04-13