Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Skp2'

169486

Institutional Source

Beutler Lab

Gene Symbol

Skp2

Ensembl Gene

ENSMUSG00000054115

Gene Name

S-phase kinase-associated protein 2 (p45)

Synonyms

FBXL1

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1503 (G1)

Quality Score

189

Status

Not validated

Chromosome

Chromosomal Location

9111985-9155425 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 9127911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 88 (V88F)

Ref Sequence

ENSEMBL: ENSMUSP00000139997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096482] [ENSMUST00000110585] [ENSMUST00000190131]

AlphaFold

Q9Z0Z3

Predicted Effect

probably damaging
Transcript: ENSMUST00000096482
AA Change: V123F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000094225
Gene: ENSMUSG00000054115
AA Change: V123F

Domain	Start	End	E-Value	Type
FBOX	100	140	3.7e-8	SMART
LRR	205	229	1.27e2	SMART
LRR	230	254	1.28e1	SMART
LRR	255	280	2.91e1	SMART
LRR	334	359	2.83e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110585
AA Change: V123F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106215
Gene: ENSMUSG00000054115
AA Change: V123F

Domain	Start	End	E-Value	Type
FBOX	100	140	3.7e-8	SMART
Blast:LRR	205	229	5e-7	BLAST
Blast:LRR	229	253	3e-7	BLAST
Blast:LRR	255	284	3e-10	BLAST
Blast:LRR	309	334	3e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000190131
AA Change: V88F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115
AA Change: V88F

Domain	Start	End	E-Value	Type
FBOX	65	105	2.3e-10	SMART
LRR	170	194	5.3e-1	SMART
LRR	195	219	5.3e-2	SMART
LRR	220	245	1.2e-1	SMART
LRR	299	324	1.2e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191316

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, enlarged cell and nuclear sizes, polyploidy, reduced cell growth rate, overduplication of centrosomes, increased apoptosis rate, delayed wound healing, and aberrant immunoglobulin V(D)J recombination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Skp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Skp2	APN	15	9139487	missense	probably benign	0.00
IGL02135:Skp2	APN	15	9125147	missense	probably benign
R0050:Skp2	UTSW	15	9125091	missense	probably benign	0.03
R0129:Skp2	UTSW	15	9125193	missense	probably damaging	1.00
R0238:Skp2	UTSW	15	9127884	critical splice donor site	probably null
R0238:Skp2	UTSW	15	9127884	critical splice donor site	probably null
R1404:Skp2	UTSW	15	9116925	nonsense	probably null
R1404:Skp2	UTSW	15	9116925	nonsense	probably null
R1660:Skp2	UTSW	15	9125114	missense	probably benign	0.03
R1746:Skp2	UTSW	15	9139443	missense	possibly damaging	0.58
R2031:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2034:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2087:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2088:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2090:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R2091:Skp2	UTSW	15	9113698	missense	probably damaging	1.00
R4272:Skp2	UTSW	15	9116860	critical splice donor site	probably null
R4428:Skp2	UTSW	15	9116947	missense	probably benign	0.21
R4747:Skp2	UTSW	15	9113839	missense	possibly damaging	0.93
R5734:Skp2	UTSW	15	9139479	missense	possibly damaging	0.85
R6963:Skp2	UTSW	15	9139428	splice site	probably null
R7452:Skp2	UTSW	15	9113832	missense	probably damaging	1.00
R7481:Skp2	UTSW	15	9113817	missense	probably damaging	0.97
R7855:Skp2	UTSW	15	9122241	missense	probably benign	0.00
R7989:Skp2	UTSW	15	9127892	missense	probably benign	0.00
R8046:Skp2	UTSW	15	9139600	missense	probably damaging	1.00
R8497:Skp2	UTSW	15	9127884	critical splice donor site	probably null
R9062:Skp2	UTSW	15	9113733	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCGACTTCCCTGACTTGAATGAC -3'
(R):5'- AAATTGGGACACTCACGGCAGC -3'

Sequencing Primer
(F):5'- CCCTGACTTGAATGACAGTAAAAAG -3'
(R):5'- caagtcacccctcctaaacc -3'

Posted On

2014-04-13