Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Drosha'

169487

Institutional Source

Beutler Lab

Gene Symbol

Drosha

Ensembl Gene

ENSMUSG00000022191

Gene Name

drosha, ribonuclease type III

Synonyms

1110013A17Rik, Rnasen, Etohi2

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12824815-12935291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12848073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 484 (C484S)

Ref Sequence

ENSEMBL: ENSMUSP00000129279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]

AlphaFold

Q5HZJ0

Predicted Effect

probably benign
Transcript: ENSMUST00000090292
AA Change: C484S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: C484S

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121499
Gene: ENSMUSG00000022191
AA Change: C126S

Domain	Start	End	E-Value	Type
low complexity region	115	142	N/A	INTRINSIC
SCOP:d1jfza_	521	545	6e-4	SMART
RIBOc	585	719	1.73e-45	SMART
Blast:RIBOc	729	755	1e-6	BLAST
RIBOc	764	896	1.6e-49	SMART
DSRM	903	975	5.75e-20	SMART
coiled coil region	988	1012	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150211

Predicted Effect

probably benign
Transcript: ENSMUST00000169061
AA Change: C484S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: C484S

Domain	Start	End	E-Value	Type
low complexity region	13	32	N/A	INTRINSIC
low complexity region	43	69	N/A	INTRINSIC
low complexity region	72	102	N/A	INTRINSIC
low complexity region	109	137	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	185	200	N/A	INTRINSIC
low complexity region	227	269	N/A	INTRINSIC
low complexity region	273	301	N/A	INTRINSIC
low complexity region	357	370	N/A	INTRINSIC
low complexity region	387	410	N/A	INTRINSIC
low complexity region	472	499	N/A	INTRINSIC
SCOP:d1jfza_	878	902	4e-4	SMART
RIBOc	942	1076	1.73e-45	SMART
Blast:RIBOc	1086	1112	1e-6	BLAST
RIBOc	1121	1253	1.6e-49	SMART
DSRM	1260	1332	5.75e-20	SMART
coiled coil region	1346	1370	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Nxf1	T	A	19: 8,762,436	F51L	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Drosha

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00576:Drosha	APN	15	12883194	missense	probably damaging	0.99
IGL00736:Drosha	APN	15	12833959	missense	unknown
IGL00963:Drosha	APN	15	12925997	missense	probably damaging	0.99
IGL01010:Drosha	APN	15	12827289	unclassified	probably benign
IGL01340:Drosha	APN	15	12834023	intron	probably benign
IGL01481:Drosha	APN	15	12842439	missense	probably benign
IGL01714:Drosha	APN	15	12878784	missense	probably damaging	1.00
IGL01721:Drosha	APN	15	12846112	nonsense	probably null
IGL01765:Drosha	APN	15	12902680	missense	probably damaging	1.00
IGL01893:Drosha	APN	15	12866650	splice site	probably benign
IGL01944:Drosha	APN	15	12889719	missense	probably damaging	1.00
IGL02285:Drosha	APN	15	12833864	missense	unknown
IGL02970:Drosha	APN	15	12913956	missense	probably damaging	0.98
IGL02990:Drosha	APN	15	12827267	unclassified	probably benign
IGL03019:Drosha	APN	15	12846099	missense	probably damaging	1.00
IGL03279:Drosha	APN	15	12859392	missense	probably benign	0.03
IGL03390:Drosha	APN	15	12884983	splice site	probably null
tippicanoe	UTSW	15	12859465	splice site	probably null
Tyler	UTSW	15	12861706	missense	probably benign	0.45
R0115:Drosha	UTSW	15	12846130	missense	probably benign	0.15
R0352:Drosha	UTSW	15	12837288	missense	unknown
R0401:Drosha	UTSW	15	12926031	nonsense	probably null
R0541:Drosha	UTSW	15	12907388	missense	probably benign	0.09
R0784:Drosha	UTSW	15	12867678	splice site	probably benign
R0918:Drosha	UTSW	15	12842533	critical splice donor site	probably null
R1473:Drosha	UTSW	15	12912520	missense	probably benign	0.04
R1526:Drosha	UTSW	15	12913984	missense	probably damaging	1.00
R1809:Drosha	UTSW	15	12890112	missense	probably null	1.00
R1859:Drosha	UTSW	15	12878718	missense	probably benign	0.14
R2004:Drosha	UTSW	15	12915381	missense	probably damaging	0.98
R2060:Drosha	UTSW	15	12924159	missense	possibly damaging	0.94
R2516:Drosha	UTSW	15	12859465	splice site	probably null
R3691:Drosha	UTSW	15	12834638	missense	unknown
R3784:Drosha	UTSW	15	12890529	missense	possibly damaging	0.82
R3789:Drosha	UTSW	15	12912537	nonsense	probably null
R3790:Drosha	UTSW	15	12912537	nonsense	probably null
R4020:Drosha	UTSW	15	12837336	missense	possibly damaging	0.96
R4817:Drosha	UTSW	15	12914047	missense	probably damaging	0.97
R4989:Drosha	UTSW	15	12935007	missense	probably benign	0.05
R5080:Drosha	UTSW	15	12842143	missense	probably benign	0.01
R5132:Drosha	UTSW	15	12837291	missense	unknown
R5215:Drosha	UTSW	15	12885133	intron	probably benign
R5386:Drosha	UTSW	15	12842121	missense	probably benign
R5457:Drosha	UTSW	15	12926029	missense	probably benign	0.26
R5536:Drosha	UTSW	15	12929711	missense	possibly damaging	0.58
R5800:Drosha	UTSW	15	12865067	missense	probably damaging	1.00
R5800:Drosha	UTSW	15	12902647	missense	probably damaging	1.00
R5915:Drosha	UTSW	15	12935066	missense	probably damaging	0.97
R5988:Drosha	UTSW	15	12834496	intron	probably benign
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6033:Drosha	UTSW	15	12925999	missense	probably benign	0.25
R6063:Drosha	UTSW	15	12834070	intron	probably benign
R6391:Drosha	UTSW	15	12889717	nonsense	probably null
R6492:Drosha	UTSW	15	12861706	missense	probably benign	0.45
R6799:Drosha	UTSW	15	12912537	nonsense	probably null
R6870:Drosha	UTSW	15	12907393	missense	probably benign	0.17
R6920:Drosha	UTSW	15	12834310	missense	unknown
R7101:Drosha	UTSW	15	12865067	missense	probably damaging	1.00
R7142:Drosha	UTSW	15	12924146	missense	possibly damaging	0.70
R7275:Drosha	UTSW	15	12846083	missense	possibly damaging	0.73
R7337:Drosha	UTSW	15	12846199	missense	possibly damaging	0.80
R7471:Drosha	UTSW	15	12889656	missense	probably damaging	1.00
R7538:Drosha	UTSW	15	12926243	missense	probably damaging	1.00
R7559:Drosha	UTSW	15	12842422	missense	probably damaging	0.96
R7651:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7652:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7653:Drosha	UTSW	15	12859436	missense	probably benign	0.30
R7727:Drosha	UTSW	15	12881645	missense	probably damaging	1.00
R7780:Drosha	UTSW	15	12848086	missense	probably benign	0.01
R8068:Drosha	UTSW	15	12883190	nonsense	probably null
R8283:Drosha	UTSW	15	12890501	missense	possibly damaging	0.47
R8523:Drosha	UTSW	15	12834322	missense	unknown
R8985:Drosha	UTSW	15	12924101	missense	possibly damaging	0.66
R9418:Drosha	UTSW	15	12885081	missense	probably benign	0.02
R9501:Drosha	UTSW	15	12928906	missense	probably damaging	1.00
R9674:Drosha	UTSW	15	12890084	missense	probably damaging	1.00
Z1177:Drosha	UTSW	15	12842092	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCAGTGGCTCAGTTGCAAGTG -3'
(R):5'- TCTCAGCCCTGCGTCGTAAATG -3'

Sequencing Primer
(F):5'- TCTGGCTCATAGAGGACTAGCTC -3'
(R):5'- CGTAAATGTGATGTGTGGGC -3'

Posted On

2014-04-13