Incidental Mutation 'R1503:Ppp1r16a'
ID 169490
Institutional Source Beutler Lab
Gene Symbol Ppp1r16a
Ensembl Gene ENSMUSG00000033819
Gene Name protein phosphatase 1, regulatory subunit 16A
Synonyms 2900084E10Rik, R75527, Mypt3
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R1503 (G1)
Quality Score 193
Status Not validated
Chromosome 15
Chromosomal Location 76555843-76579119 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76578599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 434 (H434Q)
Ref Sequence ENSEMBL: ENSMUSP00000155515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023203] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000231028] [ENSMUST00000229679] [ENSMUST00000229734]
AlphaFold Q923M0
Predicted Effect probably benign
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037551
AA Change: H434Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819
AA Change: H434Q

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably benign
Transcript: ENSMUST00000135388
AA Change: H434Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143274
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect probably benign
Transcript: ENSMUST00000229140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect probably benign
Transcript: ENSMUST00000229679
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin light chain kinase and phosphatase (MLCP) complexes control the phosphorylation states of regulatory myosin light chains, which is crucial for muscle and intracellular movement. MLCPs typically contain a catalytic protein phosphatase 1 (PP1c) subunit, a myosin phosphatase targeting (MYPT) subunit, and another smaller subunit. The protein encoded by this gene represents an MYPT subunit, which is responsible for directing PP1c to its intended targets. However, while other MYPTs result in PP1c activation after becoming phosphorylated, the encoded protein is phosphorylated by protein kinase A and then inhibits the catalytic activity of PP1c. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Ppp1r16a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Ppp1r16a APN 15 76,578,744 (GRCm39) missense probably benign
IGL01449:Ppp1r16a APN 15 76,578,494 (GRCm39) unclassified probably benign
IGL02128:Ppp1r16a APN 15 76,578,178 (GRCm39) missense probably benign
IGL02331:Ppp1r16a APN 15 76,575,200 (GRCm39) missense probably benign
R0057:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0060:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0113:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0114:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0244:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0352:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0646:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0652:Ppp1r16a UTSW 15 76,574,999 (GRCm39) unclassified probably benign
R0722:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R0744:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R0833:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R0834:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R0835:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R0836:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R0885:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R0942:Ppp1r16a UTSW 15 76,578,211 (GRCm39) missense probably damaging 0.98
R1061:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R1168:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R1170:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R1171:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R1572:Ppp1r16a UTSW 15 76,577,869 (GRCm39) nonsense probably null
R1914:Ppp1r16a UTSW 15 76,577,268 (GRCm39) missense probably damaging 1.00
R1915:Ppp1r16a UTSW 15 76,577,268 (GRCm39) missense probably damaging 1.00
R2085:Ppp1r16a UTSW 15 76,577,796 (GRCm39) missense probably damaging 0.99
R4823:Ppp1r16a UTSW 15 76,577,393 (GRCm39) unclassified probably benign
R5153:Ppp1r16a UTSW 15 76,578,596 (GRCm39) nonsense probably null
R5443:Ppp1r16a UTSW 15 76,578,846 (GRCm39) missense possibly damaging 0.95
R5481:Ppp1r16a UTSW 15 76,575,221 (GRCm39) missense probably damaging 1.00
R6900:Ppp1r16a UTSW 15 76,575,923 (GRCm39) missense probably damaging 1.00
R7165:Ppp1r16a UTSW 15 76,575,104 (GRCm39) missense probably damaging 1.00
R7686:Ppp1r16a UTSW 15 76,578,783 (GRCm39) missense probably benign 0.37
R8138:Ppp1r16a UTSW 15 76,575,921 (GRCm39) missense probably damaging 1.00
R9150:Ppp1r16a UTSW 15 76,575,054 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGCACCTCCTGATGGCTTCTG -3'
(R):5'- GAACCCTGCCATACTGAGGAATCAC -3'

Sequencing Primer
(F):5'- GGGTTCCTGGCTCTGTTCAC -3'
(R):5'- ATTGTGCTGAAGCCACAGTC -3'
Posted On 2014-04-13