Incidental Mutation 'R1503:Or2aj5'
ID 169494
Institutional Source Beutler Lab
Gene Symbol Or2aj5
Ensembl Gene ENSMUSG00000062245
Gene Name olfactory receptor family 2 subfamily AJ member 5
Synonyms Olfr170, MOR273-2, GA_x54KRFPKG5P-16052703-16051765
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R1503 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 19424475-19425416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19425062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 119 (S119P)
Ref Sequence ENSEMBL: ENSMUSP00000151806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078603] [ENSMUST00000206562] [ENSMUST00000218837]
AlphaFold Q8VGL6
Predicted Effect probably benign
Transcript: ENSMUST00000078603
AA Change: S118P

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077674
Gene: ENSMUSG00000062245
AA Change: S118P

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 1.5e-43 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206562
AA Change: S118P

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000218837
AA Change: S119P

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Dsg4 A T 18: 20,582,736 (GRCm39) I125F probably damaging Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Or2aj5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Or2aj5 APN 16 19,424,671 (GRCm39) missense probably benign 0.00
IGL02002:Or2aj5 APN 16 19,425,300 (GRCm39) missense possibly damaging 0.91
IGL02537:Or2aj5 APN 16 19,424,549 (GRCm39) missense probably damaging 1.00
IGL02881:Or2aj5 APN 16 19,425,050 (GRCm39) missense probably damaging 1.00
IGL03189:Or2aj5 APN 16 19,425,341 (GRCm39) missense probably benign
R0012:Or2aj5 UTSW 16 19,425,190 (GRCm39) missense probably benign 0.30
R0619:Or2aj5 UTSW 16 19,425,022 (GRCm39) missense probably damaging 1.00
R0764:Or2aj5 UTSW 16 19,425,182 (GRCm39) missense probably damaging 1.00
R1387:Or2aj5 UTSW 16 19,424,777 (GRCm39) missense probably damaging 1.00
R1430:Or2aj5 UTSW 16 19,424,752 (GRCm39) missense probably damaging 1.00
R1878:Or2aj5 UTSW 16 19,424,501 (GRCm39) missense probably benign
R1989:Or2aj5 UTSW 16 19,425,407 (GRCm39) missense probably benign 0.00
R2012:Or2aj5 UTSW 16 19,424,881 (GRCm39) missense probably benign 0.22
R3890:Or2aj5 UTSW 16 19,425,205 (GRCm39) missense probably damaging 1.00
R3891:Or2aj5 UTSW 16 19,425,205 (GRCm39) missense probably damaging 1.00
R5591:Or2aj5 UTSW 16 19,424,608 (GRCm39) missense probably damaging 1.00
R6158:Or2aj5 UTSW 16 19,424,675 (GRCm39) missense probably damaging 1.00
R6297:Or2aj5 UTSW 16 19,424,680 (GRCm39) missense possibly damaging 0.81
R6512:Or2aj5 UTSW 16 19,425,109 (GRCm39) missense probably damaging 1.00
R6962:Or2aj5 UTSW 16 19,424,672 (GRCm39) missense probably benign 0.00
R7252:Or2aj5 UTSW 16 19,425,249 (GRCm39) missense probably damaging 0.99
R7605:Or2aj5 UTSW 16 19,425,022 (GRCm39) missense probably damaging 1.00
R7687:Or2aj5 UTSW 16 19,424,485 (GRCm39) missense probably benign
R8302:Or2aj5 UTSW 16 19,425,116 (GRCm39) missense probably benign 0.05
R8991:Or2aj5 UTSW 16 19,424,511 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCAACATGGCAGGGACTTCAC -3'
(R):5'- TCCACAGGGATTCTCGACTCCATAC -3'

Sequencing Primer
(F):5'- CTTCACAGAAAAAGTGATCAATGGC -3'
(R):5'- GATTCTCGACTCCATACCCCAATG -3'
Posted On 2014-04-13