Incidental Mutation 'R1503:Dsg4'
ID 169498
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 039553-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R1503 (G1)
Quality Score 218
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20582736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 125 (I125F)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: I125F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: I125F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Atf7ip G T 6: 136,583,865 (GRCm39) V1299L probably damaging Het
Atp12a A T 14: 56,610,881 (GRCm39) N342Y probably damaging Het
Atp8b5 G A 4: 43,344,430 (GRCm39) G439D probably damaging Het
Bpifb2 G A 2: 153,731,430 (GRCm39) D269N possibly damaging Het
Btd T G 14: 31,389,612 (GRCm39) C444W probably damaging Het
Cacna1a A G 8: 85,328,575 (GRCm39) D1624G probably benign Het
Carmil3 A C 14: 55,735,737 (GRCm39) N563T probably damaging Het
Cars1 T C 7: 143,122,726 (GRCm39) R538G probably benign Het
Catsperd A G 17: 56,961,525 (GRCm39) K416E possibly damaging Het
Cc2d2a A T 5: 43,852,581 (GRCm39) Y386F probably damaging Het
Ccpg1 A G 9: 72,906,760 (GRCm39) N66S probably benign Het
Cd48 T A 1: 171,523,415 (GRCm39) L86H probably damaging Het
Cdan1 A T 2: 120,560,056 (GRCm39) H369Q probably damaging Het
Chil4 T C 3: 106,113,350 (GRCm39) D189G probably benign Het
Cit T A 5: 116,011,959 (GRCm39) Y189N possibly damaging Het
Cntn3 G A 6: 102,441,526 (GRCm39) Q7* probably null Het
Csn1s2a A T 5: 87,923,658 (GRCm39) I5F possibly damaging Het
Ctnnd1 C T 2: 84,435,523 (GRCm39) probably null Het
Dmxl2 A T 9: 54,354,272 (GRCm39) Y391* probably null Het
Dnah12 T C 14: 26,495,649 (GRCm39) S1426P probably damaging Het
Dnhd1 T G 7: 105,342,867 (GRCm39) S1404A possibly damaging Het
Drosha T A 15: 12,848,159 (GRCm39) C484S probably benign Het
Egfr T A 11: 16,819,301 (GRCm39) M277K possibly damaging Het
Eml5 G T 12: 98,797,433 (GRCm39) L1059I probably damaging Het
Erbb4 G T 1: 68,385,705 (GRCm39) H295N probably benign Het
Etl4 T G 2: 20,748,685 (GRCm39) V139G possibly damaging Het
Fhip1a T A 3: 85,579,784 (GRCm39) Y807F possibly damaging Het
Frem3 A T 8: 81,413,647 (GRCm39) E1969D probably damaging Het
Gdf3 T A 6: 122,583,296 (GRCm39) D357V probably damaging Het
Gimap8 T A 6: 48,624,463 (GRCm39) probably null Het
Gml2 C A 15: 74,693,201 (GRCm39) S68* probably null Het
Gphn A G 12: 78,551,403 (GRCm39) I248V possibly damaging Het
Greb1 A T 12: 16,774,820 (GRCm39) Y192* probably null Het
Hmbs A C 9: 44,248,729 (GRCm39) L215W probably benign Het
Iglon5 T A 7: 43,128,449 (GRCm39) T123S probably benign Het
Ints2 C T 11: 86,117,607 (GRCm39) R705H probably damaging Het
Ints8 A T 4: 11,245,842 (GRCm39) L212Q probably damaging Het
Itgad A G 7: 127,797,293 (GRCm39) Y846C probably benign Het
Kcnj1 A G 9: 32,307,788 (GRCm39) T51A probably damaging Het
Kif9 A T 9: 110,339,506 (GRCm39) K449N possibly damaging Het
Kifbp A G 10: 62,395,187 (GRCm39) V485A probably damaging Het
Klk1b11 G A 7: 43,428,333 (GRCm39) W241* probably null Het
Krt32 T C 11: 99,974,936 (GRCm39) probably null Het
Loxl1 A G 9: 58,200,923 (GRCm39) F513S probably damaging Het
Mapk8ip3 A T 17: 25,123,897 (GRCm39) S571T probably damaging Het
Mcam C T 9: 44,052,588 (GRCm39) R606C probably damaging Het
Mtss1 T C 15: 58,823,521 (GRCm39) N282S probably damaging Het
Myh13 T A 11: 67,244,500 (GRCm39) D1012E probably benign Het
Myo16 A G 8: 10,552,817 (GRCm39) T952A probably benign Het
Neb T C 2: 52,188,632 (GRCm39) D874G probably damaging Het
Nek11 A G 9: 105,040,403 (GRCm39) Y553H probably damaging Het
Nr2c2 T A 6: 92,082,312 (GRCm39) V9D probably benign Het
Nxf1 T A 19: 8,739,800 (GRCm39) F51L probably benign Het
Or1e1f T G 11: 73,855,394 (GRCm39) probably null Het
Or1j15 A T 2: 36,458,885 (GRCm39) I92F probably damaging Het
Or2aj5 A G 16: 19,425,062 (GRCm39) S119P probably benign Het
Or4c35 T C 2: 89,808,872 (GRCm39) V250A probably damaging Het
Or5bw2 A G 7: 6,573,470 (GRCm39) N160S probably damaging Het
Or6s1 A G 14: 51,308,191 (GRCm39) S220P probably damaging Het
Or6z6 T C 7: 6,491,178 (GRCm39) I232V probably damaging Het
Pcdhb8 A T 18: 37,489,572 (GRCm39) N76Y probably damaging Het
Pdzrn4 T A 15: 92,297,685 (GRCm39) F217I probably damaging Het
Ppp1r16a T A 15: 76,578,599 (GRCm39) H434Q probably benign Het
Prpf19 T A 19: 10,878,386 (GRCm39) F291I possibly damaging Het
R3hdm2 G T 10: 127,307,695 (GRCm39) E319* probably null Het
Sel1l3 A G 5: 53,295,271 (GRCm39) Y777H probably damaging Het
Serpinb5 G A 1: 106,798,019 (GRCm39) A3T possibly damaging Het
Skp2 C A 15: 9,127,998 (GRCm39) V88F probably damaging Het
Slc25a16 T C 10: 62,764,155 (GRCm39) Y71H probably damaging Het
Slc6a6 T A 6: 91,717,973 (GRCm39) I304N probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Sox17 C A 1: 4,562,151 (GRCm39) G222C probably damaging Het
Trmu T A 15: 85,779,220 (GRCm39) V289E possibly damaging Het
Vdac2 A G 14: 21,887,945 (GRCm39) E96G probably damaging Het
Wdhd1 A T 14: 47,484,857 (GRCm39) D885E probably benign Het
Zfp646 A G 7: 127,479,308 (GRCm39) N495S probably damaging Het
Zfp663 T C 2: 165,194,573 (GRCm39) T549A probably damaging Het
Zfp935 G A 13: 62,602,951 (GRCm39) A83V possibly damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGAAGGAGCTAAGTTGGTGTCCC -3'
(R):5'- TCGAGCCATAGATCGGAATGGAGTC -3'

Sequencing Primer
(F):5'- AAGTTGGTGTCCCATGTACTAC -3'
(R):5'- ATGATGCTGAACACTGGCTC -3'
Posted On 2014-04-13