Mutagenetix > Incidental Mutation

Incidental Mutation 'R1503:Nxf1'

169500

Institutional Source

Beutler Lab

Gene Symbol

Nxf1

Ensembl Gene

ENSMUSG00000010097

Gene Name

nuclear RNA export factor 1

Synonyms

Tip associated protein, Mex67, TAP, Mvb1

MMRRC Submission

039553-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1503 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8757073-8772475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8762436 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 51 (F51L)

Ref Sequence

ENSEMBL: ENSMUSP00000139124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010241] [ENSMUST00000183939] [ENSMUST00000184756] [ENSMUST00000184970]

AlphaFold

Q99JX7

Predicted Effect

probably benign
Transcript: ENSMUST00000010241
AA Change: F51L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097
AA Change: F51L

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
low complexity region	67	81	N/A	INTRINSIC
Pfam:Tap-RNA_bind	115	198	7.6e-42	PFAM
low complexity region	258	274	N/A	INTRINSIC
LRRcap	333	351	1.44e0	SMART
Pfam:NTF2	385	535	1.3e-29	PFAM
TAP_C	555	618	1.85e-33	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183780

Predicted Effect

probably benign
Transcript: ENSMUST00000183939

SMART Domains

Protein: ENSMUSP00000139351
Gene: ENSMUSG00000010097

Domain	Start	End	E-Value	Type
Pfam:Tap-RNA_bind	1	63	5.7e-28	PFAM
low complexity region	122	138	N/A	INTRINSIC
Pfam:LRR_1	155	178	2.1e-2	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184387

Predicted Effect

probably benign
Transcript: ENSMUST00000184756
AA Change: F51L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139050
Gene: ENSMUSG00000010097
AA Change: F51L

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184970
AA Change: F51L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097
AA Change: F51L

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
low complexity region	67	81	N/A	INTRINSIC
Pfam:Tap-RNA_bind	112	199	2.4e-45	PFAM
low complexity region	258	274	N/A	INTRINSIC
Pfam:LRR_1	291	314	3.2e-2	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185056

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some alleles are able to suppress defects caused by retrovirus insertion mutations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef6	T	C	X: 57,338,562	M5V	probably benign	Het
Atf7ip	G	T	6: 136,606,867	V1299L	probably damaging	Het
Atp12a	A	T	14: 56,373,424	N342Y	probably damaging	Het
Atp8b5	G	A	4: 43,344,430	G439D	probably damaging	Het
Bpifb2	G	A	2: 153,889,510	D269N	possibly damaging	Het
Btd	T	G	14: 31,667,655	C444W	probably damaging	Het
Cacna1a	A	G	8: 84,601,946	D1624G	probably benign	Het
Carmil3	A	C	14: 55,498,280	N563T	probably damaging	Het
Cars	T	C	7: 143,568,989	R538G	probably benign	Het
Catsperd	A	G	17: 56,654,525	K416E	possibly damaging	Het
Cc2d2a	A	T	5: 43,695,239	Y386F	probably damaging	Het
Ccpg1	A	G	9: 72,999,478	N66S	probably benign	Het
Cd48	T	A	1: 171,695,847	L86H	probably damaging	Het
Cdan1	A	T	2: 120,729,575	H369Q	probably damaging	Het
Chil4	T	C	3: 106,206,034	D189G	probably benign	Het
Cit	T	A	5: 115,873,900	Y189N	possibly damaging	Het
Cntn3	G	A	6: 102,464,565	Q7*	probably null	Het
Csn1s2a	A	T	5: 87,775,799	I5F	possibly damaging	Het
Ctnnd1	C	T	2: 84,605,179		probably null	Het
Dmxl2	A	T	9: 54,446,988	Y391*	probably null	Het
Dnah12	T	C	14: 26,773,692	S1426P	probably damaging	Het
Dnhd1	T	G	7: 105,693,660	S1404A	possibly damaging	Het
Drosha	T	A	15: 12,848,073	C484S	probably benign	Het
Dsg4	A	T	18: 20,449,679	I125F	probably damaging	Het
Egfr	T	A	11: 16,869,301	M277K	possibly damaging	Het
Eml5	G	T	12: 98,831,174	L1059I	probably damaging	Het
Erbb4	G	T	1: 68,346,546	H295N	probably benign	Het
Etl4	T	G	2: 20,743,874	V139G	possibly damaging	Het
Fam160a1	T	A	3: 85,672,477	Y807F	possibly damaging	Het
Frem3	A	T	8: 80,687,018	E1969D	probably damaging	Het
Gdf3	T	A	6: 122,606,337	D357V	probably damaging	Het
Gimap8	T	A	6: 48,647,529		probably null	Het
Gml2	C	A	15: 74,821,352	S68*	probably null	Het
Gphn	A	G	12: 78,504,629	I248V	possibly damaging	Het
Greb1	A	T	12: 16,724,819	Y192*	probably null	Het
Hmbs	A	C	9: 44,337,432	L215W	probably benign	Het
Iglon5	T	A	7: 43,479,025	T123S	probably benign	Het
Ints2	C	T	11: 86,226,781	R705H	probably damaging	Het
Ints8	A	T	4: 11,245,842	L212Q	probably damaging	Het
Itgad	A	G	7: 128,198,121	Y846C	probably benign	Het
Kcnj1	A	G	9: 32,396,492	T51A	probably damaging	Het
Kif1bp	A	G	10: 62,559,408	V485A	probably damaging	Het
Kif9	A	T	9: 110,510,438	K449N	possibly damaging	Het
Klk11	G	A	7: 43,778,909	W241*	probably null	Het
Krt32	T	C	11: 100,084,110		probably null	Het
Loxl1	A	G	9: 58,293,640	F513S	probably damaging	Het
Mapk8ip3	A	T	17: 24,904,923	S571T	probably damaging	Het
Mcam	C	T	9: 44,141,291	R606C	probably damaging	Het
Mtss1	T	C	15: 58,951,672	N282S	probably damaging	Het
Myh13	T	A	11: 67,353,674	D1012E	probably benign	Het
Myo16	A	G	8: 10,502,817	T952A	probably benign	Het
Neb	T	C	2: 52,298,620	D874G	probably damaging	Het
Nek11	A	G	9: 105,163,204	Y553H	probably damaging	Het
Nr2c2	T	A	6: 92,105,331	V9D	probably benign	Het
Olfr1260	T	C	2: 89,978,528	V250A	probably damaging	Het
Olfr1347	T	C	7: 6,488,179	I232V	probably damaging	Het
Olfr1350	A	G	7: 6,570,471	N160S	probably damaging	Het
Olfr170	A	G	16: 19,606,312	S119P	probably benign	Het
Olfr344	A	T	2: 36,568,873	I92F	probably damaging	Het
Olfr397	T	G	11: 73,964,568		probably null	Het
Olfr750	A	G	14: 51,070,734	S220P	probably damaging	Het
Pcdhb8	A	T	18: 37,356,519	N76Y	probably damaging	Het
Pdzrn4	T	A	15: 92,399,804	F217I	probably damaging	Het
Ppp1r16a	T	A	15: 76,694,399	H434Q	probably benign	Het
Prpf19	T	A	19: 10,901,022	F291I	possibly damaging	Het
R3hdm2	G	T	10: 127,471,826	E319*	probably null	Het
Sel1l3	A	G	5: 53,137,929	Y777H	probably damaging	Het
Serpinb5	G	A	1: 106,870,289	A3T	possibly damaging	Het
Skp2	C	A	15: 9,127,911	V88F	probably damaging	Het
Slc25a16	T	C	10: 62,928,376	Y71H	probably damaging	Het
Slc6a6	T	A	6: 91,740,992	I304N	probably damaging	Het
Sned1	G	A	1: 93,281,654	V830M	possibly damaging	Het
Sox17	C	A	1: 4,491,928	G222C	probably damaging	Het
Trmu	T	A	15: 85,895,019	V289E	possibly damaging	Het
Vdac2	A	G	14: 21,837,877	E96G	probably damaging	Het
Wdhd1	A	T	14: 47,247,400	D885E	probably benign	Het
Zfp646	A	G	7: 127,880,136	N495S	probably damaging	Het
Zfp663	T	C	2: 165,352,653	T549A	probably damaging	Het
Zfp935	G	A	13: 62,455,137	A83V	possibly damaging	Het

Other mutations in Nxf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Nxf1	APN	19	8762742	missense	possibly damaging	0.95
IGL02318:Nxf1	APN	19	8764150	critical splice donor site	probably null
IGL03383:Nxf1	APN	19	8763697	missense	probably damaging	1.00
Chance	UTSW	19	8769182	missense	probably damaging	1.00
Necessity	UTSW	19	8767754	missense	probably damaging	1.00
Possibility	UTSW	19	8767744	missense	probably damaging	1.00
Probability	UTSW	19	8764317	missense	probably benign	0.01
R0125:Nxf1	UTSW	19	8762806	missense	probably benign	0.37
R0362:Nxf1	UTSW	19	8764151	critical splice donor site	probably null
R0374:Nxf1	UTSW	19	8767739	missense	possibly damaging	0.86
R0403:Nxf1	UTSW	19	8765028	missense	probably damaging	1.00
R0883:Nxf1	UTSW	19	8764591	missense	probably damaging	1.00
R1004:Nxf1	UTSW	19	8764317	missense	probably benign	0.01
R1068:Nxf1	UTSW	19	8762754	missense	probably damaging	0.97
R1669:Nxf1	UTSW	19	8772131	missense	possibly damaging	0.93
R1679:Nxf1	UTSW	19	8769074	missense	probably benign
R4424:Nxf1	UTSW	19	8766764	utr 3 prime	probably benign
R4608:Nxf1	UTSW	19	8762763	missense	probably benign	0.03
R4783:Nxf1	UTSW	19	8766798	missense	probably benign	0.01
R4969:Nxf1	UTSW	19	8762305	splice site	probably null
R5233:Nxf1	UTSW	19	8763929	missense	possibly damaging	0.67
R5370:Nxf1	UTSW	19	8772140	missense	probably damaging	1.00
R6024:Nxf1	UTSW	19	8767744	missense	probably damaging	1.00
R6058:Nxf1	UTSW	19	8767822	missense	probably damaging	1.00
R6063:Nxf1	UTSW	19	8767787	missense	possibly damaging	0.46
R6293:Nxf1	UTSW	19	8769182	missense	probably damaging	1.00
R6378:Nxf1	UTSW	19	8764546	missense	probably benign	0.19
R8170:Nxf1	UTSW	19	8771050	missense	probably benign	0.02
R8317:Nxf1	UTSW	19	8771043	missense	probably benign
R9110:Nxf1	UTSW	19	8767754	missense	probably damaging	1.00
R9506:Nxf1	UTSW	19	8772144	missense	probably damaging	0.99
R9701:Nxf1	UTSW	19	8762408	missense	probably damaging	1.00
R9802:Nxf1	UTSW	19	8762408	missense	probably damaging	1.00
RF021:Nxf1	UTSW	19	8772309	missense	probably damaging	1.00
X0024:Nxf1	UTSW	19	8763764	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CTGTGTCTGTTTCCAACTCCAGAGC -3'
(R):5'- GATCTCGATCATGCCAACCATCTCC -3'

Sequencing Primer
(F):5'- GTTTCCAACTCCAGAGCATGATG -3'
(R):5'- TGTCCTGCTAGTGAAACTACAGC -3'

Posted On

2014-04-13