Mutagenetix > Incidental Mutation

Incidental Mutation 'R1536:Galnt3'

169508

Institutional Source

Beutler Lab

Gene Symbol

Galnt3

Ensembl Gene

ENSMUSG00000026994

Gene Name

polypeptide N-acetylgalactosaminyltransferase 3

Synonyms

ppGaNTase-T3

MMRRC Submission

039575-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.395) question?

Stock #

R1536 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66082766-66124994 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66084206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 622 (D622E)

Ref Sequence

ENSEMBL: ENSMUSP00000028378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028378]

AlphaFold

P70419

Predicted Effect

probably damaging
Transcript: ENSMUST00000028378
AA Change: D622E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028378
Gene: ENSMUSG00000026994
AA Change: D622E

Domain	Start	End	E-Value	Type
transmembrane domain	20	37	N/A	INTRINSIC
coiled coil region	44	75	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	185	440	8.3e-10	PFAM
Pfam:Glycos_transf_2	188	374	1.2e-35	PFAM
Pfam:Glyco_transf_7C	345	423	7.7e-14	PFAM
RICIN	506	630	2.71e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155453

Meta Mutation Damage Score

0.0988

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes UDP-GalNAc transferase 3, a member of the GalNAc-transferases family. This family transfers an N-acetyl galactosamine to the hydroxyl group of a serine or threonine residue in the first step of O-linked oligosaccharide biosynthesis. Individual GalNAc-transferases have distinct activities and initiation of O-glycosylation is regulated by a repertoire of GalNAc-transferases. The protein encoded by this gene is highly homologous to other family members, however the enzymes have different substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating alkaline phosphatase, hypercalcemia, hyperphosphatemia, decreased circulating parathyroid hormone, and male specific postnatal growth retardation, infertility, and increase in bone density. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,970,665	I3F	probably benign	Het
4930590J08Rik	A	G	6: 91,917,035	N211S	probably benign	Het
A2ml1	A	T	6: 128,547,233	Y1145*	probably null	Het
Abca7	A	G	10: 80,014,230	D1972G	probably benign	Het
Adamts19	A	T	18: 59,052,615	D1187V	probably damaging	Het
Adcy6	G	C	15: 98,600,007	I421M	probably damaging	Het
Afap1	C	A	5: 35,974,491	H387Q	probably damaging	Het
Atp8b1	C	T	18: 64,545,264	V854M	probably damaging	Het
Auts2	C	T	5: 131,487,463		probably benign	Het
Cbll1	T	C	12: 31,487,856	D300G	probably damaging	Het
Cd200r4	A	T	16: 44,833,049	T61S	possibly damaging	Het
Chmp4c	G	T	3: 10,389,684	V207L	probably benign	Het
Cntn5	T	C	9: 9,976,316	T413A	possibly damaging	Het
Cox7a2	T	A	9: 79,758,581		probably null	Het
Cwc27	A	G	13: 104,797,306	L236P	probably damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dst	T	A	1: 34,260,372		probably benign	Het
Ear1	T	A	14: 43,819,126	H95L	probably damaging	Het
Enpp1	T	A	10: 24,641,834	H898L	probably benign	Het
Entpd5	G	A	12: 84,382,295	R321*	probably null	Het
Ercc6l2	C	A	13: 63,824,871	N177K	possibly damaging	Het
Ergic1	T	C	17: 26,641,706		probably null	Het
Erich6	A	T	3: 58,626,598	I336N	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Gjd4	T	A	18: 9,280,569	T170S	probably damaging	Het
Gm5611	G	A	9: 17,030,607		noncoding transcript	Het
Gpc5	T	A	14: 115,399,250	N448K	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Man2b2	T	C	5: 36,820,927	T338A	probably benign	Het
Mbtps1	A	T	8: 119,546,125	S94T	probably benign	Het
Muc3a	A	T	5: 137,210,081	S205T	unknown	Het
Nav2	C	A	7: 49,545,934	D1019E	probably damaging	Het
Neurl4	T	A	11: 69,903,426	L236*	probably null	Het
Olfr272	A	G	4: 52,911,260	V178A	probably benign	Het
Plcxd3	T	C	15: 4,516,611		probably benign	Het
Pprc1	T	C	19: 46,071,526		probably benign	Het
Prkaa2	T	A	4: 105,075,450	N67I	probably damaging	Het
Prom1	T	A	5: 44,018,353	Y508F	probably benign	Het
Prx	A	G	7: 27,517,258	M534V	probably damaging	Het
Rps6kc1	C	T	1: 190,871,768	R219Q	possibly damaging	Het
Sbf2	T	C	7: 110,378,043	Y628C	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Spata31	A	T	13: 64,921,382	Q448L	probably damaging	Het
Stk35	T	C	2: 129,811,235		probably benign	Het
Stxbp5	T	A	10: 9,838,092	R234S	probably damaging	Het
Tifab	A	G	13: 56,176,288	V114A	probably benign	Het
Tiprl	A	G	1: 165,228,406	M49T	probably benign	Het
Tlr12	A	G	4: 128,617,752	L235P	possibly damaging	Het
Tmem57	A	G	4: 134,804,507	V617A	probably damaging	Het
Trim43b	A	T	9: 89,085,358	C407*	probably null	Het
Txndc17	C	A	11: 72,207,707	F28L	probably damaging	Het
Vmn2r27	T	C	6: 124,200,690	R452G	probably damaging	Het
Vmn2r3	T	A	3: 64,275,117	D387V	probably damaging	Het
Vps13b	T	C	15: 35,875,566	I2699T	probably damaging	Het
Zfp944	G	T	17: 22,339,716	Y183*	probably null	Het

Other mutations in Galnt3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Galnt3	APN	2	66095284	missense	probably damaging	1.00
IGL01563:Galnt3	APN	2	66097757	missense	probably damaging	0.97
IGL01973:Galnt3	APN	2	66084262	missense	probably benign	0.03
IGL02004:Galnt3	APN	2	66095926	missense	probably damaging	1.00
IGL02424:Galnt3	APN	2	66095788	critical splice donor site	probably null
IGL02946:Galnt3	APN	2	66095218	missense	probably damaging	0.99
IGL03059:Galnt3	APN	2	66093610	missense	probably damaging	1.00
PIT4531001:Galnt3	UTSW	2	66107088	missense	probably benign	0.03
R0437:Galnt3	UTSW	2	66107229	missense	possibly damaging	0.74
R1390:Galnt3	UTSW	2	66091223	missense	probably damaging	1.00
R1869:Galnt3	UTSW	2	66097779	missense	possibly damaging	0.82
R2987:Galnt3	UTSW	2	66084241	missense	probably benign	0.00
R3973:Galnt3	UTSW	2	66107030	missense	possibly damaging	0.77
R4039:Galnt3	UTSW	2	66085327	missense	probably damaging	0.96
R4515:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4518:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4519:Galnt3	UTSW	2	66093610	missense	probably damaging	1.00
R4577:Galnt3	UTSW	2	66097859	missense	probably benign	0.02
R4817:Galnt3	UTSW	2	66093539	missense	possibly damaging	0.83
R5008:Galnt3	UTSW	2	66085241	missense	probably benign	0.04
R5191:Galnt3	UTSW	2	66093706	missense	probably damaging	1.00
R5947:Galnt3	UTSW	2	66084156	utr 3 prime	probably benign
R6534:Galnt3	UTSW	2	66102531	missense	probably damaging	1.00
R7196:Galnt3	UTSW	2	66090924	missense	probably damaging	1.00
R7817:Galnt3	UTSW	2	66095899	missense	probably damaging	1.00
R7951:Galnt3	UTSW	2	66097842	missense	probably benign	0.00
R7952:Galnt3	UTSW	2	66097842	missense	probably benign	0.00
R8071:Galnt3	UTSW	2	66091211	missense	probably benign	0.28
R8513:Galnt3	UTSW	2	66093720	nonsense	probably null
R8844:Galnt3	UTSW	2	66085292	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCTGTGCTTTCAGACAGAAACCC -3'
(R):5'- CCATCAGGCCGTGTTTGCATTTATC -3'

Sequencing Primer
(F):5'- TGCAGCGGTTCTACATAGAC -3'
(R):5'- GGCCGTGTTTGCATTTATCTTTTAAC -3'

Posted On

2014-04-13