Incidental Mutation 'R1536:Tlr12'
ID169516
Institutional Source Beutler Lab
Gene Symbol Tlr12
Ensembl Gene ENSMUSG00000062545
Gene Nametoll-like receptor 12
SynonymsLOC384059, Tlr11
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1536 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location128615443-128618619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128617752 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 235 (L235P)
Ref Sequence ENSEMBL: ENSMUSP00000074381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074829
AA Change: L235P

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074381
Gene: ENSMUSG00000062545
AA Change: L235P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
LRR 291 314 1.67e2 SMART
LRR 315 338 9.24e1 SMART
LRR_TYP 341 364 2.79e-4 SMART
LRR 365 388 4.34e-1 SMART
LRR 389 412 1.37e1 SMART
LRR 413 436 1.71e2 SMART
low complexity region 443 459 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
LRR 591 614 5.56e0 SMART
Pfam:TIR 760 905 5.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133382
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit a greatly increased susceptibility to kidney infection by uropathogenic bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Tlr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tlr12 APN 4 128617422 missense probably benign 0.00
IGL00654:Tlr12 APN 4 128617440 missense probably benign 0.27
IGL01290:Tlr12 APN 4 128617837 missense probably damaging 1.00
IGL01406:Tlr12 APN 4 128616339 nonsense probably null
IGL01550:Tlr12 APN 4 128615742 missense probably damaging 1.00
IGL02590:Tlr12 APN 4 128617389 missense probably benign 0.00
IGL02592:Tlr12 APN 4 128617686 missense probably benign 0.02
IGL02635:Tlr12 APN 4 128616816 missense probably damaging 0.98
IGL02714:Tlr12 APN 4 128617713 missense probably damaging 1.00
IGL03104:Tlr12 APN 4 128615892 missense probably benign 0.01
IGL03131:Tlr12 APN 4 128615877 missense probably damaging 1.00
IGL03329:Tlr12 APN 4 128616852 missense possibly damaging 0.84
IGL03354:Tlr12 APN 4 128615937 missense probably damaging 1.00
R0848:Tlr12 UTSW 4 128616291 missense probably benign 0.05
R1807:Tlr12 UTSW 4 128617436 missense probably benign 0.21
R1989:Tlr12 UTSW 4 128617069 missense probably benign 0.04
R2905:Tlr12 UTSW 4 128616009 missense probably damaging 1.00
R3870:Tlr12 UTSW 4 128616568 missense probably benign 0.00
R4026:Tlr12 UTSW 4 128616508 missense probably benign 0.00
R4296:Tlr12 UTSW 4 128617788 missense probably damaging 1.00
R4398:Tlr12 UTSW 4 128616195 missense probably benign 0.09
R4528:Tlr12 UTSW 4 128618025 missense probably damaging 1.00
R4559:Tlr12 UTSW 4 128615770 missense probably damaging 1.00
R4599:Tlr12 UTSW 4 128617332 missense probably benign 0.06
R4999:Tlr12 UTSW 4 128617680 missense probably benign 0.38
R5054:Tlr12 UTSW 4 128617270 nonsense probably null
R5177:Tlr12 UTSW 4 128618376 missense probably damaging 0.96
R5207:Tlr12 UTSW 4 128616709 nonsense probably null
R5533:Tlr12 UTSW 4 128615863 missense probably damaging 0.99
R6484:Tlr12 UTSW 4 128616054 missense probably damaging 1.00
R6568:Tlr12 UTSW 4 128617992 missense probably benign 0.10
R6821:Tlr12 UTSW 4 128616892 missense possibly damaging 0.95
R7465:Tlr12 UTSW 4 128616170 missense probably damaging 1.00
R7594:Tlr12 UTSW 4 128617680 missense probably benign 0.38
R7810:Tlr12 UTSW 4 128616708 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTAGGCCAGTGCTTGAAAGACCC -3'
(R):5'- TGATGCCTTCAGTGACCTGATTTCC -3'

Sequencing Primer
(F):5'- AGCCAGAGCCTCCTGAGATATA -3'
(R):5'- ACGCTCAGTTGCATTCAGG -3'
Posted On2014-04-13