Mutagenetix > Incidental Mutation

Incidental Mutation 'R1536:Auts2'

169522

Institutional Source

Beutler Lab

Gene Symbol

Auts2

Ensembl Gene

ENSMUSG00000029673

Gene Name

autism susceptibility candidate 2

Synonyms

D830032G16Rik, 2700063G02Rik, A730011F23Rik

MMRRC Submission

039575-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1536 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131437333-132543344 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 131487463 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161374] [ENSMUST00000161804]

AlphaFold

A0A087WPF7

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160071

SMART Domains

Protein: ENSMUSP00000125349
Gene: ENSMUSG00000029673

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	67	84	N/A	INTRINSIC
low complexity region	92	105	N/A	INTRINSIC
Pfam:Auts2	194	406	2.3e-108	PFAM
low complexity region	433	446	N/A	INTRINSIC
low complexity region	555	565	N/A	INTRINSIC
low complexity region	621	636	N/A	INTRINSIC
low complexity region	763	779	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161226

SMART Domains

Protein: ENSMUSP00000124900
Gene: ENSMUSG00000029673

Domain	Start	End	E-Value	Type
low complexity region	11	45	N/A	INTRINSIC
low complexity region	62	82	N/A	INTRINSIC
low complexity region	133	150	N/A	INTRINSIC
low complexity region	199	214	N/A	INTRINSIC
low complexity region	297	315	N/A	INTRINSIC
low complexity region	330	355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161374

SMART Domains

Protein: ENSMUSP00000124730
Gene: ENSMUSG00000029673

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	67	84	N/A	INTRINSIC
low complexity region	92	105	N/A	INTRINSIC
Pfam:Auts2	172	384	1.5e-112	PFAM
low complexity region	411	424	N/A	INTRINSIC
low complexity region	533	543	N/A	INTRINSIC
low complexity region	599	614	N/A	INTRINSIC
low complexity region	741	757	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161804

SMART Domains

Protein: ENSMUSP00000124027
Gene: ENSMUSG00000029673

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	67	84	N/A	INTRINSIC
low complexity region	92	105	N/A	INTRINSIC
Pfam:Auts2	187	399	3.9e-113	PFAM
low complexity region	426	439	N/A	INTRINSIC
low complexity region	548	558	N/A	INTRINSIC
low complexity region	614	629	N/A	INTRINSIC
low complexity region	756	772	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000178463
AA Change: G140E

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182575

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183153

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a brain-specific knockout are smaller than controls, and exhibit behavioral defects such as less vocalizations, impairments in righting response and geotaxis, and decreased food intake. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,970,665	I3F	probably benign	Het
4930590J08Rik	A	G	6: 91,917,035	N211S	probably benign	Het
A2ml1	A	T	6: 128,547,233	Y1145*	probably null	Het
Abca7	A	G	10: 80,014,230	D1972G	probably benign	Het
Adamts19	A	T	18: 59,052,615	D1187V	probably damaging	Het
Adcy6	G	C	15: 98,600,007	I421M	probably damaging	Het
Afap1	C	A	5: 35,974,491	H387Q	probably damaging	Het
Atp8b1	C	T	18: 64,545,264	V854M	probably damaging	Het
Cbll1	T	C	12: 31,487,856	D300G	probably damaging	Het
Cd200r4	A	T	16: 44,833,049	T61S	possibly damaging	Het
Chmp4c	G	T	3: 10,389,684	V207L	probably benign	Het
Cntn5	T	C	9: 9,976,316	T413A	possibly damaging	Het
Cox7a2	T	A	9: 79,758,581		probably null	Het
Cwc27	A	G	13: 104,797,306	L236P	probably damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dst	T	A	1: 34,260,372		probably benign	Het
Ear1	T	A	14: 43,819,126	H95L	probably damaging	Het
Enpp1	T	A	10: 24,641,834	H898L	probably benign	Het
Entpd5	G	A	12: 84,382,295	R321*	probably null	Het
Ercc6l2	C	A	13: 63,824,871	N177K	possibly damaging	Het
Ergic1	T	C	17: 26,641,706		probably null	Het
Erich6	A	T	3: 58,626,598	I336N	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt3	A	T	2: 66,084,206	D622E	probably damaging	Het
Gjd4	T	A	18: 9,280,569	T170S	probably damaging	Het
Gm5611	G	A	9: 17,030,607		noncoding transcript	Het
Gpc5	T	A	14: 115,399,250	N448K	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Man2b2	T	C	5: 36,820,927	T338A	probably benign	Het
Mbtps1	A	T	8: 119,546,125	S94T	probably benign	Het
Muc3a	A	T	5: 137,210,081	S205T	unknown	Het
Nav2	C	A	7: 49,545,934	D1019E	probably damaging	Het
Neurl4	T	A	11: 69,903,426	L236*	probably null	Het
Olfr272	A	G	4: 52,911,260	V178A	probably benign	Het
Plcxd3	T	C	15: 4,516,611		probably benign	Het
Pprc1	T	C	19: 46,071,526		probably benign	Het
Prkaa2	T	A	4: 105,075,450	N67I	probably damaging	Het
Prom1	T	A	5: 44,018,353	Y508F	probably benign	Het
Prx	A	G	7: 27,517,258	M534V	probably damaging	Het
Rps6kc1	C	T	1: 190,871,768	R219Q	possibly damaging	Het
Sbf2	T	C	7: 110,378,043	Y628C	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Spata31	A	T	13: 64,921,382	Q448L	probably damaging	Het
Stk35	T	C	2: 129,811,235		probably benign	Het
Stxbp5	T	A	10: 9,838,092	R234S	probably damaging	Het
Tifab	A	G	13: 56,176,288	V114A	probably benign	Het
Tiprl	A	G	1: 165,228,406	M49T	probably benign	Het
Tlr12	A	G	4: 128,617,752	L235P	possibly damaging	Het
Tmem57	A	G	4: 134,804,507	V617A	probably damaging	Het
Trim43b	A	T	9: 89,085,358	C407*	probably null	Het
Txndc17	C	A	11: 72,207,707	F28L	probably damaging	Het
Vmn2r27	T	C	6: 124,200,690	R452G	probably damaging	Het
Vmn2r3	T	A	3: 64,275,117	D387V	probably damaging	Het
Vps13b	T	C	15: 35,875,566	I2699T	probably damaging	Het
Zfp944	G	T	17: 22,339,716	Y183*	probably null	Het

Other mutations in Auts2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01739:Auts2	APN	5	131440218	missense	probably benign	0.00
IGL01751:Auts2	APN	5	131472360	missense	probably damaging	0.99
IGL02070:Auts2	APN	5	131470421	missense	probably damaging	1.00
R0032:Auts2	UTSW	5	131440093	missense	probably damaging	1.00
R0033:Auts2	UTSW	5	131440093	missense	probably damaging	1.00
R0046:Auts2	UTSW	5	131770785	exon	noncoding transcript
R0399:Auts2	UTSW	5	131440524	missense	probably benign	0.37
R0412:Auts2	UTSW	5	131446831	missense	probably benign	0.02
R0551:Auts2	UTSW	5	131440469	missense	possibly damaging	0.75
R1573:Auts2	UTSW	5	131440487	missense	probably damaging	1.00
R1789:Auts2	UTSW	5	131472450	missense	probably damaging	1.00
R1912:Auts2	UTSW	5	131443574	missense	probably damaging	1.00
R2431:Auts2	UTSW	5	132259048	nonsense	probably null
R3745:Auts2	UTSW	5	131476587	utr 5 prime	probably benign
R4290:Auts2	UTSW	5	131474971	missense	probably damaging	1.00
R4575:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4576:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4578:Auts2	UTSW	5	132258934	missense	probably benign	0.17
R4623:Auts2	UTSW	5	131440383	missense	probably benign	0.25
R4632:Auts2	UTSW	5	131472275	missense	probably damaging	1.00
R4663:Auts2	UTSW	5	131439638	missense	probably damaging	1.00
R4835:Auts2	UTSW	5	131466093	missense	probably damaging	1.00
R4881:Auts2	UTSW	5	131472450	missense	probably damaging	1.00
R5030:Auts2	UTSW	5	131443498	missense	probably benign	0.00
R5032:Auts2	UTSW	5	131476891	utr 5 prime	probably benign
R5078:Auts2	UTSW	5	132258947	missense	possibly damaging	0.85
R5093:Auts2	UTSW	5	131439458	missense	probably damaging	0.99
R5182:Auts2	UTSW	5	131475081	missense	probably null	0.01
R5305:Auts2	UTSW	5	131443794	intron	probably benign
R5429:Auts2	UTSW	5	131472335	missense	probably damaging	1.00
R5601:Auts2	UTSW	5	131476823	utr 5 prime	probably benign
R5725:Auts2	UTSW	5	131439746	missense	probably benign	0.35
R5990:Auts2	UTSW	5	131476895	utr 5 prime	probably benign
R6074:Auts2	UTSW	5	131476989	utr 5 prime	probably benign
R6130:Auts2	UTSW	5	131440223	missense	probably damaging	1.00
R6321:Auts2	UTSW	5	131466115	missense	probably damaging	1.00
R6974:Auts2	UTSW	5	131440599	missense	probably benign	0.01
R7000:Auts2	UTSW	5	131440218	missense	probably benign	0.01
R7014:Auts2	UTSW	5	131466123	missense	probably damaging	1.00
R7154:Auts2	UTSW	5	131451893	missense
R7812:Auts2	UTSW	5	131472446	missense
R7922:Auts2	UTSW	5	131440373	missense
R8159:Auts2	UTSW	5	131460125	critical splice donor site	probably null
R8553:Auts2	UTSW	5	131440143	missense	probably benign	0.00
R8873:Auts2	UTSW	5	131443664	missense
R8970:Auts2	UTSW	5	132258952	missense	possibly damaging	0.52
R9348:Auts2	UTSW	5	131461317	missense
R9500:Auts2	UTSW	5	131476781	missense	unknown
Z1088:Auts2	UTSW	5	131476554	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGTCTTGTCCCCAACAGCAAGCC -3'
(R):5'- TGTCACGTCCAGCTTCACTATAGCC -3'

Sequencing Primer
(F):5'- TGCATCTATCTCTACACACAGAATG -3'
(R):5'- CCCAGGCCAAGAGCAGTTAG -3'

Posted On

2014-04-13