Incidental Mutation 'R1536:Muc3a'
ID169523
Institutional Source Beutler Lab
Gene Symbol Muc3a
Ensembl Gene ENSMUSG00000094840
Gene Namemucin 3A, cell surface associated
SynonymsA630081J09Rik
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1536 (G1)
Quality Score222
Status Validated
Chromosome5
Chromosomal Location137208813-137212389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137210081 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 205 (S205T)
Ref Sequence ENSEMBL: ENSMUSP00000136061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179412]
Predicted Effect unknown
Transcript: ENSMUST00000179412
AA Change: S205T
SMART Domains Protein: ENSMUSP00000136061
Gene: ENSMUSG00000094840
AA Change: S205T

DomainStartEndE-ValueType
Blast:EGF_like 54 95 1e-22 BLAST
transmembrane domain 103 125 N/A INTRINSIC
low complexity region 198 218 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000196391
AA Change: S203T
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mucin genes encode epithelial glycoproteins, some of which are secreted and some membrane bound. Each of the genes contains at least one large domain of tandemly repeated sequence that encodes the peptide sequence rich in serine and/or threonine residues, which carries most of the O-linked glycosylation (Gendler and Spicer, 1995 [PubMed 7778880]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Muc3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1500:Muc3a UTSW 5 137210501 splice site probably benign
R5076:Muc3a UTSW 5 137210540 missense probably damaging 0.99
R5356:Muc3a UTSW 5 137210564 missense probably benign 0.33
R6134:Muc3a UTSW 5 137210122 missense probably damaging 0.99
R6491:Muc3a UTSW 5 137212128 missense probably benign 0.00
R7524:Muc3a UTSW 5 137210563 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGGAGATATAAGCCCTGCTACCCG -3'
(R):5'- GCCTTGGAGAAGGTGGATACCAAC -3'

Sequencing Primer
(F):5'- gcatcacacccatttcacag -3'
(R):5'- TACCAACATGATGGTGAGGTC -3'
Posted On2014-04-13