Mutagenetix > Incidental Mutation

Incidental Mutation 'R1536:A2ml1'

169526

Institutional Source

Beutler Lab

Gene Symbol

A2ml1

Ensembl Gene

ENSMUSG00000047228

Gene Name

alpha-2-macroglobulin like 1

Synonyms

MMRRC Submission

039575-MU

Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1536 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128539821-128581608 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 128547233 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1145 (Y1145*)

Ref Sequence

ENSEMBL: ENSMUSP00000059426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060574]

AlphaFold

Q3UU35

Predicted Effect

probably null
Transcript: ENSMUST00000060574
AA Change: Y1145*

SMART Domains

Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: Y1145*

Domain	Start	End	E-Value	Type
low complexity region	42	58	N/A	INTRINSIC
Pfam:A2M_N	120	213	6.3e-17	PFAM
A2M_N_2	448	594	2.95e-37	SMART
A2M	736	826	2.11e-33	SMART
Pfam:Thiol-ester_cl	959	988	3.1e-17	PFAM
Pfam:A2M_comp	1008	1255	2.3e-71	PFAM
A2M_recep	1361	1447	1.22e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203291

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205167

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

98% (59/60)

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,970,665	I3F	probably benign	Het
4930590J08Rik	A	G	6: 91,917,035	N211S	probably benign	Het
Abca7	A	G	10: 80,014,230	D1972G	probably benign	Het
Adamts19	A	T	18: 59,052,615	D1187V	probably damaging	Het
Adcy6	G	C	15: 98,600,007	I421M	probably damaging	Het
Afap1	C	A	5: 35,974,491	H387Q	probably damaging	Het
Atp8b1	C	T	18: 64,545,264	V854M	probably damaging	Het
Auts2	C	T	5: 131,487,463		probably benign	Het
Cbll1	T	C	12: 31,487,856	D300G	probably damaging	Het
Cd200r4	A	T	16: 44,833,049	T61S	possibly damaging	Het
Chmp4c	G	T	3: 10,389,684	V207L	probably benign	Het
Cntn5	T	C	9: 9,976,316	T413A	possibly damaging	Het
Cox7a2	T	A	9: 79,758,581		probably null	Het
Cwc27	A	G	13: 104,797,306	L236P	probably damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dst	T	A	1: 34,260,372		probably benign	Het
Ear1	T	A	14: 43,819,126	H95L	probably damaging	Het
Enpp1	T	A	10: 24,641,834	H898L	probably benign	Het
Entpd5	G	A	12: 84,382,295	R321*	probably null	Het
Ercc6l2	C	A	13: 63,824,871	N177K	possibly damaging	Het
Ergic1	T	C	17: 26,641,706		probably null	Het
Erich6	A	T	3: 58,626,598	I336N	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt3	A	T	2: 66,084,206	D622E	probably damaging	Het
Gjd4	T	A	18: 9,280,569	T170S	probably damaging	Het
Gm5611	G	A	9: 17,030,607		noncoding transcript	Het
Gpc5	T	A	14: 115,399,250	N448K	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Man2b2	T	C	5: 36,820,927	T338A	probably benign	Het
Mbtps1	A	T	8: 119,546,125	S94T	probably benign	Het
Muc3a	A	T	5: 137,210,081	S205T	unknown	Het
Nav2	C	A	7: 49,545,934	D1019E	probably damaging	Het
Neurl4	T	A	11: 69,903,426	L236*	probably null	Het
Olfr272	A	G	4: 52,911,260	V178A	probably benign	Het
Plcxd3	T	C	15: 4,516,611		probably benign	Het
Pprc1	T	C	19: 46,071,526		probably benign	Het
Prkaa2	T	A	4: 105,075,450	N67I	probably damaging	Het
Prom1	T	A	5: 44,018,353	Y508F	probably benign	Het
Prx	A	G	7: 27,517,258	M534V	probably damaging	Het
Rps6kc1	C	T	1: 190,871,768	R219Q	possibly damaging	Het
Sbf2	T	C	7: 110,378,043	Y628C	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Spata31	A	T	13: 64,921,382	Q448L	probably damaging	Het
Stk35	T	C	2: 129,811,235		probably benign	Het
Stxbp5	T	A	10: 9,838,092	R234S	probably damaging	Het
Tifab	A	G	13: 56,176,288	V114A	probably benign	Het
Tiprl	A	G	1: 165,228,406	M49T	probably benign	Het
Tlr12	A	G	4: 128,617,752	L235P	possibly damaging	Het
Tmem57	A	G	4: 134,804,507	V617A	probably damaging	Het
Trim43b	A	T	9: 89,085,358	C407*	probably null	Het
Txndc17	C	A	11: 72,207,707	F28L	probably damaging	Het
Vmn2r27	T	C	6: 124,200,690	R452G	probably damaging	Het
Vmn2r3	T	A	3: 64,275,117	D387V	probably damaging	Het
Vps13b	T	C	15: 35,875,566	I2699T	probably damaging	Het
Zfp944	G	T	17: 22,339,716	Y183*	probably null	Het

Other mutations in A2ml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:A2ml1	APN	6	128578156	missense	possibly damaging	0.78
IGL00596:A2ml1	APN	6	128570067	missense	probably damaging	0.99
IGL00912:A2ml1	APN	6	128552307	missense	probably benign	0.04
IGL01320:A2ml1	APN	6	128575588	missense	probably benign	0.00
IGL01470:A2ml1	APN	6	128580412	missense	probably damaging	0.96
IGL01576:A2ml1	APN	6	128554330	splice site	probably benign
IGL01761:A2ml1	APN	6	128546337	missense	possibly damaging	0.61
IGL01792:A2ml1	APN	6	128560679	missense	probably benign	0.04
IGL01843:A2ml1	APN	6	128553338	splice site	probably benign
IGL01946:A2ml1	APN	6	128570479	missense	possibly damaging	0.81
IGL02016:A2ml1	APN	6	128558335	missense	probably damaging	1.00
IGL02170:A2ml1	APN	6	128547210	missense	possibly damaging	0.58
IGL02269:A2ml1	APN	6	128553338	splice site	probably benign
IGL02589:A2ml1	APN	6	128581500	missense	probably benign	0.00
IGL02959:A2ml1	APN	6	128567060	missense	probably benign	0.04
IGL02970:A2ml1	APN	6	128569979	missense	probably damaging	1.00
IGL03206:A2ml1	APN	6	128553276	missense	possibly damaging	0.50
IGL03298:A2ml1	APN	6	128543960	missense	probably benign	0.00
1mM(1):A2ml1	UTSW	6	128580960	missense	probably benign	0.02
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0055:A2ml1	UTSW	6	128570094	splice site	probably benign
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0069:A2ml1	UTSW	6	128561562	missense	probably damaging	1.00
R0128:A2ml1	UTSW	6	128575639	splice site	probably benign
R0299:A2ml1	UTSW	6	128553232	splice site	probably benign
R0523:A2ml1	UTSW	6	128558326	missense	possibly damaging	0.92
R0565:A2ml1	UTSW	6	128568743	nonsense	probably null
R0599:A2ml1	UTSW	6	128552245	missense	probably damaging	1.00
R0626:A2ml1	UTSW	6	128550773	missense	probably damaging	0.99
R0732:A2ml1	UTSW	6	128546448	missense	probably damaging	1.00
R0880:A2ml1	UTSW	6	128560646	missense	possibly damaging	0.49
R1070:A2ml1	UTSW	6	128543300	missense	probably damaging	1.00
R1166:A2ml1	UTSW	6	128570917	missense	probably benign	0.00
R1278:A2ml1	UTSW	6	128558507	missense	probably damaging	1.00
R1421:A2ml1	UTSW	6	128543960	missense	probably benign	0.00
R1786:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R1808:A2ml1	UTSW	6	128543299	missense	probably damaging	1.00
R1813:A2ml1	UTSW	6	128566273	missense	probably benign	0.34
R1863:A2ml1	UTSW	6	128550783	missense	probably damaging	0.99
R2007:A2ml1	UTSW	6	128542892	missense	probably benign	0.13
R2062:A2ml1	UTSW	6	128552308	missense	probably benign	0.08
R2127:A2ml1	UTSW	6	128558437	missense	probably damaging	1.00
R2130:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2131:A2ml1	UTSW	6	128576260	missense	probably damaging	1.00
R2201:A2ml1	UTSW	6	128547305	missense	probably null	0.34
R2319:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2321:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2322:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2369:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2370:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2371:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2372:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2375:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2893:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R2894:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3438:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R3615:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3616:A2ml1	UTSW	6	128558294	missense	probably benign	0.07
R3773:A2ml1	UTSW	6	128555083	missense	probably benign	0.02
R3785:A2ml1	UTSW	6	128544924	critical splice donor site	probably null
R3803:A2ml1	UTSW	6	128545070	missense	probably benign	0.17
R3824:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R3878:A2ml1	UTSW	6	128554361	missense	probably benign	0.05
R4176:A2ml1	UTSW	6	128545037	missense	possibly damaging	0.68
R4229:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4230:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4348:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4351:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4352:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4353:A2ml1	UTSW	6	128580386	missense	probably benign	0.01
R4427:A2ml1	UTSW	6	128545046	missense	probably benign	0.00
R4971:A2ml1	UTSW	6	128547227	missense	probably damaging	0.98
R5014:A2ml1	UTSW	6	128543933	missense	probably benign	0.00
R5369:A2ml1	UTSW	6	128568833	missense	probably damaging	0.97
R5532:A2ml1	UTSW	6	128553330	critical splice acceptor site	probably null
R5860:A2ml1	UTSW	6	128541061	missense	probably benign	0.15
R5872:A2ml1	UTSW	6	128561526	missense	probably damaging	1.00
R5926:A2ml1	UTSW	6	128560645	missense	probably benign
R5977:A2ml1	UTSW	6	128581122	missense	probably damaging	1.00
R5980:A2ml1	UTSW	6	128567055	missense	possibly damaging	0.82
R6014:A2ml1	UTSW	6	128571985	missense	probably damaging	1.00
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6032:A2ml1	UTSW	6	128549836	nonsense	probably null
R6061:A2ml1	UTSW	6	128568712	missense	probably damaging	1.00
R6327:A2ml1	UTSW	6	128558692	splice site	probably null
R6331:A2ml1	UTSW	6	128552236	missense	probably damaging	0.96
R6465:A2ml1	UTSW	6	128541078	missense	probably damaging	1.00
R6640:A2ml1	UTSW	6	128553285	missense	probably benign	0.41
R6792:A2ml1	UTSW	6	128546329	nonsense	probably null
R6793:A2ml1	UTSW	6	128546329	nonsense	probably null
R7207:A2ml1	UTSW	6	128550771	missense	probably benign	0.04
R7378:A2ml1	UTSW	6	128546247	critical splice donor site	probably null
R7556:A2ml1	UTSW	6	128569964	missense	probably damaging	1.00
R8010:A2ml1	UTSW	6	128580340	missense	probably benign	0.08
R8017:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8019:A2ml1	UTSW	6	128581447	critical splice donor site	probably null
R8035:A2ml1	UTSW	6	128553280	missense	probably damaging	0.99
R8094:A2ml1	UTSW	6	128572082	missense	probably damaging	1.00
R8144:A2ml1	UTSW	6	128569999	missense	possibly damaging	0.84
R8365:A2ml1	UTSW	6	128580955	nonsense	probably null
R8382:A2ml1	UTSW	6	128560682	missense	probably benign	0.01
R8388:A2ml1	UTSW	6	128571974	missense	probably benign	0.03
R8717:A2ml1	UTSW	6	128566995	missense	probably benign	0.00
R8947:A2ml1	UTSW	6	128552256	missense	probably damaging	1.00
R8970:A2ml1	UTSW	6	128568763	missense	probably damaging	0.99
R9025:A2ml1	UTSW	6	128557582	missense	possibly damaging	0.49
R9083:A2ml1	UTSW	6	128557561	missense	possibly damaging	0.90
R9129:A2ml1	UTSW	6	128546260	missense	probably damaging	1.00
R9145:A2ml1	UTSW	6	128559069	missense	probably benign
R9165:A2ml1	UTSW	6	128560669	missense	probably benign
R9285:A2ml1	UTSW	6	128549793	missense	probably benign
R9408:A2ml1	UTSW	6	128545067	missense	probably damaging	0.98
R9486:A2ml1	UTSW	6	128569979	missense	probably damaging	0.99
R9781:A2ml1	UTSW	6	128542897	missense	probably benign	0.01
RF014:A2ml1	UTSW	6	128570068	missense	probably damaging	0.96
X0063:A2ml1	UTSW	6	128572012	missense	probably benign
Z1176:A2ml1	UTSW	6	128571977	missense	probably benign	0.09
Z1177:A2ml1	UTSW	6	128545076	missense	probably benign
Z1177:A2ml1	UTSW	6	128561616	nonsense	probably null
Z1177:A2ml1	UTSW	6	128575607	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGATTCCTGCTGTGGTCTGAATCTTAAA -3'
(R):5'- CGGTAAACTCCTGAAATGTTGGGGTG -3'

Sequencing Primer
(F):5'- ttcacacacagagggcag -3'
(R):5'- AAATGTTGGGGTGTTACTTACAAGC -3'

Posted On

2014-04-13