Mutagenetix > Incidental Mutation

Incidental Mutation 'R1536:Nav2'

169530

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

039575-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.705) question?

Stock #

R1536 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 49545934 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1019 (D1019E)

Ref Sequence

ENSEMBL: ENSMUSP00000139045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]

AlphaFold

E9Q842

Predicted Effect

probably damaging
Transcript: ENSMUST00000064395
AA Change: D1019E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: D1019E

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183659
AA Change: D958E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: D958E

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184109

SMART Domains

Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512

Domain	Start	End	E-Value	Type
low complexity region	154	171	N/A	INTRINSIC
low complexity region	179	196	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000184945
AA Change: D1019E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: D1019E

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,970,665	I3F	probably benign	Het
4930590J08Rik	A	G	6: 91,917,035	N211S	probably benign	Het
A2ml1	A	T	6: 128,547,233	Y1145*	probably null	Het
Abca7	A	G	10: 80,014,230	D1972G	probably benign	Het
Adamts19	A	T	18: 59,052,615	D1187V	probably damaging	Het
Adcy6	G	C	15: 98,600,007	I421M	probably damaging	Het
Afap1	C	A	5: 35,974,491	H387Q	probably damaging	Het
Atp8b1	C	T	18: 64,545,264	V854M	probably damaging	Het
Auts2	C	T	5: 131,487,463		probably benign	Het
Cbll1	T	C	12: 31,487,856	D300G	probably damaging	Het
Cd200r4	A	T	16: 44,833,049	T61S	possibly damaging	Het
Chmp4c	G	T	3: 10,389,684	V207L	probably benign	Het
Cntn5	T	C	9: 9,976,316	T413A	possibly damaging	Het
Cox7a2	T	A	9: 79,758,581		probably null	Het
Cwc27	A	G	13: 104,797,306	L236P	probably damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dst	T	A	1: 34,260,372		probably benign	Het
Ear1	T	A	14: 43,819,126	H95L	probably damaging	Het
Enpp1	T	A	10: 24,641,834	H898L	probably benign	Het
Entpd5	G	A	12: 84,382,295	R321*	probably null	Het
Ercc6l2	C	A	13: 63,824,871	N177K	possibly damaging	Het
Ergic1	T	C	17: 26,641,706		probably null	Het
Erich6	A	T	3: 58,626,598	I336N	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt3	A	T	2: 66,084,206	D622E	probably damaging	Het
Gjd4	T	A	18: 9,280,569	T170S	probably damaging	Het
Gm5611	G	A	9: 17,030,607		noncoding transcript	Het
Gpc5	T	A	14: 115,399,250	N448K	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Man2b2	T	C	5: 36,820,927	T338A	probably benign	Het
Mbtps1	A	T	8: 119,546,125	S94T	probably benign	Het
Muc3a	A	T	5: 137,210,081	S205T	unknown	Het
Neurl4	T	A	11: 69,903,426	L236*	probably null	Het
Olfr272	A	G	4: 52,911,260	V178A	probably benign	Het
Plcxd3	T	C	15: 4,516,611		probably benign	Het
Pprc1	T	C	19: 46,071,526		probably benign	Het
Prkaa2	T	A	4: 105,075,450	N67I	probably damaging	Het
Prom1	T	A	5: 44,018,353	Y508F	probably benign	Het
Prx	A	G	7: 27,517,258	M534V	probably damaging	Het
Rps6kc1	C	T	1: 190,871,768	R219Q	possibly damaging	Het
Sbf2	T	C	7: 110,378,043	Y628C	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Spata31	A	T	13: 64,921,382	Q448L	probably damaging	Het
Stk35	T	C	2: 129,811,235		probably benign	Het
Stxbp5	T	A	10: 9,838,092	R234S	probably damaging	Het
Tifab	A	G	13: 56,176,288	V114A	probably benign	Het
Tiprl	A	G	1: 165,228,406	M49T	probably benign	Het
Tlr12	A	G	4: 128,617,752	L235P	possibly damaging	Het
Tmem57	A	G	4: 134,804,507	V617A	probably damaging	Het
Trim43b	A	T	9: 89,085,358	C407*	probably null	Het
Txndc17	C	A	11: 72,207,707	F28L	probably damaging	Het
Vmn2r27	T	C	6: 124,200,690	R452G	probably damaging	Het
Vmn2r3	T	A	3: 64,275,117	D387V	probably damaging	Het
Vps13b	T	C	15: 35,875,566	I2699T	probably damaging	Het
Zfp944	G	T	17: 22,339,716	Y183*	probably null	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0006:Nav2	UTSW	7	49453230	missense	possibly damaging	0.50
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1734:Nav2	UTSW	7	49575720	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R1997:Nav2	UTSW	7	49548471	missense	probably benign	0.16
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49572298	splice site	probably null
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	splice site	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7315:Nav2	UTSW	7	49548289	missense	possibly damaging	0.61
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
R8097:Nav2	UTSW	7	49587777	missense	probably damaging	1.00
R8110:Nav2	UTSW	7	49551950	nonsense	probably null
R8119:Nav2	UTSW	7	49453484	missense	probably damaging	0.99
R8298:Nav2	UTSW	7	49554261	critical splice donor site	probably null
R8306:Nav2	UTSW	7	49546017	missense	probably benign	0.33
R8331:Nav2	UTSW	7	49452623	missense	probably benign
R8402:Nav2	UTSW	7	49453437	missense	probably benign	0.43
R8421:Nav2	UTSW	7	49452521	missense	probably benign
R8478:Nav2	UTSW	7	49461985	missense	probably damaging	0.99
R8724:Nav2	UTSW	7	49491436	missense	possibly damaging	0.82
R8753:Nav2	UTSW	7	49452572	missense	probably benign
R8835:Nav2	UTSW	7	49598803	missense	possibly damaging	0.83
R8933:Nav2	UTSW	7	49461957	missense	probably damaging	1.00
R8957:Nav2	UTSW	7	49571216	missense	probably damaging	1.00
R9069:Nav2	UTSW	7	49558813	missense	probably damaging	0.99
R9095:Nav2	UTSW	7	49604545	missense	probably damaging	1.00
R9223:Nav2	UTSW	7	49552851	missense	probably damaging	1.00
R9261:Nav2	UTSW	7	49597156	missense	probably damaging	1.00
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAGTAGTCCCCGTATTGTCTCGGC -3'
(R):5'- CGATTGTGGGCAAAACAGCAACC -3'

Sequencing Primer
(F):5'- TTCAGCATGTGTCCTGTCCA -3'
(R):5'- AAAGTCACCATGATTTGGCCTC -3'

Posted On

2014-04-13