Incidental Mutation 'R1536:Sbf2'
ID 169531
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene Name SET binding factor 2
Synonyms B430219L04Rik, 4833411B01Rik, SBF2, Mtmr13, mMTMH1
MMRRC Submission 039575-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R1536 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 109907220-110214129 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109977250 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 628 (Y628C)
Ref Sequence ENSEMBL: ENSMUSP00000126217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]
AlphaFold E9PXF8
Predicted Effect probably damaging
Transcript: ENSMUST00000033058
AA Change: Y674C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: Y674C

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164759
AA Change: Y674C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: Y674C

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165449
Predicted Effect probably damaging
Transcript: ENSMUST00000166020
AA Change: Y628C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: Y628C

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171378
Meta Mutation Damage Score 0.8090 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,118,524 (GRCm39) I3F probably benign Het
4930590J08Rik A G 6: 91,894,016 (GRCm39) N211S probably benign Het
A2ml1 A T 6: 128,524,196 (GRCm39) Y1145* probably null Het
Abca7 A G 10: 79,850,064 (GRCm39) D1972G probably benign Het
Adamts19 A T 18: 59,185,687 (GRCm39) D1187V probably damaging Het
Adcy6 G C 15: 98,497,888 (GRCm39) I421M probably damaging Het
Afap1 C A 5: 36,131,835 (GRCm39) H387Q probably damaging Het
Atp8b1 C T 18: 64,678,335 (GRCm39) V854M probably damaging Het
Auts2 C T 5: 131,516,302 (GRCm39) probably benign Het
Cbll1 T C 12: 31,537,855 (GRCm39) D300G probably damaging Het
Cd200r4 A T 16: 44,653,412 (GRCm39) T61S possibly damaging Het
Chmp4c G T 3: 10,454,744 (GRCm39) V207L probably benign Het
Cntn5 T C 9: 9,976,321 (GRCm39) T413A possibly damaging Het
Cox7a2 T A 9: 79,665,863 (GRCm39) probably null Het
Cwc27 A G 13: 104,933,814 (GRCm39) L236P probably damaging Het
Diaph1 A G 18: 38,029,146 (GRCm39) probably null Het
Dst T A 1: 34,299,453 (GRCm39) probably benign Het
Ear1 T A 14: 44,056,583 (GRCm39) H95L probably damaging Het
Enpp1 T A 10: 24,517,732 (GRCm39) H898L probably benign Het
Entpd5 G A 12: 84,429,069 (GRCm39) R321* probably null Het
Ercc6l2 C A 13: 63,972,685 (GRCm39) N177K possibly damaging Het
Ergic1 T C 17: 26,860,680 (GRCm39) probably null Het
Erich6 A T 3: 58,534,019 (GRCm39) I336N probably benign Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Galnt3 A T 2: 65,914,550 (GRCm39) D622E probably damaging Het
Gjd4 T A 18: 9,280,569 (GRCm39) T170S probably damaging Het
Gm5611 G A 9: 16,941,903 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 115,636,662 (GRCm39) N448K probably benign Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Maco1 A G 4: 134,531,818 (GRCm39) V617A probably damaging Het
Man2b2 T C 5: 36,978,271 (GRCm39) T338A probably benign Het
Mbtps1 A T 8: 120,272,864 (GRCm39) S94T probably benign Het
Muc3a A T 5: 137,244,538 (GRCm39) S205T unknown Het
Nav2 C A 7: 49,195,682 (GRCm39) D1019E probably damaging Het
Neurl4 T A 11: 69,794,252 (GRCm39) L236* probably null Het
Or13c25 A G 4: 52,911,260 (GRCm39) V178A probably benign Het
Plcxd3 T C 15: 4,546,093 (GRCm39) probably benign Het
Pprc1 T C 19: 46,059,965 (GRCm39) probably benign Het
Prkaa2 T A 4: 104,932,647 (GRCm39) N67I probably damaging Het
Prom1 T A 5: 44,175,695 (GRCm39) Y508F probably benign Het
Prx A G 7: 27,216,683 (GRCm39) M534V probably damaging Het
Rps6kc1 C T 1: 190,603,965 (GRCm39) R219Q possibly damaging Het
Slc1a2 A T 2: 102,607,855 (GRCm39) D501V probably benign Het
Spata31 A T 13: 65,069,196 (GRCm39) Q448L probably damaging Het
Stk35 T C 2: 129,653,155 (GRCm39) probably benign Het
Stxbp5 T A 10: 9,713,836 (GRCm39) R234S probably damaging Het
Tifab A G 13: 56,324,101 (GRCm39) V114A probably benign Het
Tiprl A G 1: 165,055,975 (GRCm39) M49T probably benign Het
Tlr12 A G 4: 128,511,545 (GRCm39) L235P possibly damaging Het
Trim43b A T 9: 88,967,411 (GRCm39) C407* probably null Het
Txndc17 C A 11: 72,098,533 (GRCm39) F28L probably damaging Het
Vmn2r27 T C 6: 124,177,649 (GRCm39) R452G probably damaging Het
Vmn2r3 T A 3: 64,182,538 (GRCm39) D387V probably damaging Het
Vps13b T C 15: 35,875,712 (GRCm39) I2699T probably damaging Het
Zfp944 G T 17: 22,558,697 (GRCm39) Y183* probably null Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 109,975,039 (GRCm39) splice site probably benign
IGL01089:Sbf2 APN 7 109,948,169 (GRCm39) missense probably damaging 1.00
IGL01144:Sbf2 APN 7 109,929,110 (GRCm39) missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110,046,327 (GRCm39) missense probably damaging 1.00
IGL01950:Sbf2 APN 7 109,965,032 (GRCm39) missense probably benign 0.00
IGL02027:Sbf2 APN 7 110,060,348 (GRCm39) missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110,159,502 (GRCm39) missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110,062,163 (GRCm39) missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110,062,139 (GRCm39) missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 109,911,959 (GRCm39) missense probably benign
R0084:Sbf2 UTSW 7 110,041,573 (GRCm39) missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 109,920,013 (GRCm39) splice site probably benign
R0121:Sbf2 UTSW 7 110,088,426 (GRCm39) critical splice donor site probably null
R0464:Sbf2 UTSW 7 110,063,783 (GRCm39) splice site probably benign
R0505:Sbf2 UTSW 7 109,998,550 (GRCm39) missense probably damaging 1.00
R0531:Sbf2 UTSW 7 109,966,530 (GRCm39) splice site probably benign
R0554:Sbf2 UTSW 7 110,027,494 (GRCm39) missense probably damaging 1.00
R0617:Sbf2 UTSW 7 109,929,890 (GRCm39) frame shift probably null
R0619:Sbf2 UTSW 7 109,909,469 (GRCm39) missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 109,940,562 (GRCm39) missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 109,970,859 (GRCm39) missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 109,966,379 (GRCm39) splice site probably benign
R1167:Sbf2 UTSW 7 109,963,756 (GRCm39) missense probably damaging 1.00
R1169:Sbf2 UTSW 7 109,909,391 (GRCm39) missense probably benign 0.04
R1424:Sbf2 UTSW 7 109,914,233 (GRCm39) missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110,027,553 (GRCm39) missense probably damaging 1.00
R1601:Sbf2 UTSW 7 109,939,283 (GRCm39) critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 109,911,965 (GRCm39) missense probably benign
R1771:Sbf2 UTSW 7 110,060,353 (GRCm39) nonsense probably null
R1989:Sbf2 UTSW 7 109,948,130 (GRCm39) missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110,060,419 (GRCm39) missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110,159,502 (GRCm39) missense probably damaging 1.00
R2444:Sbf2 UTSW 7 109,929,905 (GRCm39) missense probably benign 0.31
R3765:Sbf2 UTSW 7 109,974,788 (GRCm39) missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110,088,487 (GRCm39) makesense probably null
R3895:Sbf2 UTSW 7 110,046,298 (GRCm39) missense probably damaging 0.99
R3978:Sbf2 UTSW 7 109,929,092 (GRCm39) missense probably benign 0.00
R4056:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110,040,673 (GRCm39) missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110,027,449 (GRCm39) missense probably damaging 1.00
R4569:Sbf2 UTSW 7 109,948,060 (GRCm39) critical splice donor site probably null
R4670:Sbf2 UTSW 7 109,934,606 (GRCm39) missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110,020,124 (GRCm39) missense probably damaging 1.00
R4792:Sbf2 UTSW 7 109,950,817 (GRCm39) missense probably damaging 0.98
R4811:Sbf2 UTSW 7 109,971,742 (GRCm39) missense probably damaging 1.00
R4822:Sbf2 UTSW 7 109,977,146 (GRCm39) intron probably benign
R5110:Sbf2 UTSW 7 109,963,864 (GRCm39) missense probably benign 0.10
R5143:Sbf2 UTSW 7 110,021,747 (GRCm39) nonsense probably null
R5443:Sbf2 UTSW 7 109,977,135 (GRCm39) intron probably benign
R5457:Sbf2 UTSW 7 109,912,037 (GRCm39) missense probably benign
R5641:Sbf2 UTSW 7 110,038,108 (GRCm39) missense probably damaging 1.00
R5915:Sbf2 UTSW 7 109,977,303 (GRCm39) nonsense probably null
R5948:Sbf2 UTSW 7 110,088,492 (GRCm39) missense probably damaging 1.00
R5977:Sbf2 UTSW 7 109,977,193 (GRCm39) missense probably benign 0.00
R6052:Sbf2 UTSW 7 110,040,741 (GRCm39) missense probably damaging 1.00
R6142:Sbf2 UTSW 7 109,948,182 (GRCm39) missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110,040,759 (GRCm39) missense probably damaging 1.00
R6356:Sbf2 UTSW 7 109,971,830 (GRCm39) missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110,062,070 (GRCm39) missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110,040,182 (GRCm39) missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110,159,505 (GRCm39) missense probably benign 0.04
R6986:Sbf2 UTSW 7 109,929,822 (GRCm39) missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110,046,268 (GRCm39) missense probably benign 0.01
R7358:Sbf2 UTSW 7 109,998,555 (GRCm39) missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 109,913,271 (GRCm39) missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 109,965,028 (GRCm39) missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110,038,055 (GRCm39) missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 109,974,984 (GRCm39) nonsense probably null
R7431:Sbf2 UTSW 7 109,950,957 (GRCm39) missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110,213,923 (GRCm39) nonsense probably null
R7556:Sbf2 UTSW 7 109,913,260 (GRCm39) missense probably benign 0.20
R7604:Sbf2 UTSW 7 109,977,274 (GRCm39) missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 109,929,920 (GRCm39) critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110,040,633 (GRCm39) missense probably benign 0.01
R7812:Sbf2 UTSW 7 110,049,170 (GRCm39) missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 109,971,717 (GRCm39) missense probably damaging 1.00
R8026:Sbf2 UTSW 7 109,934,594 (GRCm39) missense probably damaging 1.00
R8048:Sbf2 UTSW 7 109,914,289 (GRCm39) missense probably benign 0.21
R8305:Sbf2 UTSW 7 109,970,825 (GRCm39) missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110,040,669 (GRCm39) missense probably benign
R8773:Sbf2 UTSW 7 109,948,202 (GRCm39) missense probably benign
R8786:Sbf2 UTSW 7 110,063,793 (GRCm39) critical splice donor site probably null
R8812:Sbf2 UTSW 7 109,929,069 (GRCm39) missense probably damaging 1.00
R8876:Sbf2 UTSW 7 110,049,146 (GRCm39) missense probably damaging 0.99
R8932:Sbf2 UTSW 7 110,040,155 (GRCm39) critical splice donor site probably null
R8954:Sbf2 UTSW 7 110,038,118 (GRCm39) nonsense probably null
R8991:Sbf2 UTSW 7 109,911,896 (GRCm39) missense probably benign 0.20
R9119:Sbf2 UTSW 7 109,911,292 (GRCm39) missense possibly damaging 0.93
R9310:Sbf2 UTSW 7 109,914,292 (GRCm39) missense possibly damaging 0.58
R9344:Sbf2 UTSW 7 109,940,535 (GRCm39) missense probably benign 0.10
R9346:Sbf2 UTSW 7 109,919,946 (GRCm39) missense probably benign 0.05
R9404:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9406:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9408:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9472:Sbf2 UTSW 7 109,970,798 (GRCm39) missense possibly damaging 0.88
R9554:Sbf2 UTSW 7 110,040,671 (GRCm39) missense probably damaging 1.00
R9562:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9624:Sbf2 UTSW 7 109,963,857 (GRCm39) missense probably damaging 1.00
R9652:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9653:Sbf2 UTSW 7 110,040,702 (GRCm39) missense possibly damaging 0.81
R9709:Sbf2 UTSW 7 110,027,514 (GRCm39) missense probably damaging 0.99
RF005:Sbf2 UTSW 7 109,916,215 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACATCTGCCTGAGCTTCCTTC -3'
(R):5'- GTACACCACCTTGTTCACACCAGAG -3'

Sequencing Primer
(F):5'- GAGCTTCCTTCAAGTCAATCCTAAG -3'
(R):5'- TGCAGTTGAACATGAATACAGTGC -3'
Posted On 2014-04-13