Mutagenetix > Incidental Mutation

Incidental Mutation 'R1536:Sbf2'

169531

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

MMRRC Submission

039575-MU

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Essential gene?

Possibly non essential (E-score: 0.295) question?

Stock #

R1536 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110378043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 628 (Y628C)

Ref Sequence

ENSEMBL: ENSMUSP00000126217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020]

AlphaFold

E9PXF8

Predicted Effect

probably damaging
Transcript: ENSMUST00000033058
AA Change: Y674C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: Y674C

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000164759
AA Change: Y674C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: Y674C

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165449

Predicted Effect

probably damaging
Transcript: ENSMUST00000166020
AA Change: Y628C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: Y628C

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171378

Meta Mutation Damage Score

0.8090

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,970,665	I3F	probably benign	Het
4930590J08Rik	A	G	6: 91,917,035	N211S	probably benign	Het
A2ml1	A	T	6: 128,547,233	Y1145*	probably null	Het
Abca7	A	G	10: 80,014,230	D1972G	probably benign	Het
Adamts19	A	T	18: 59,052,615	D1187V	probably damaging	Het
Adcy6	G	C	15: 98,600,007	I421M	probably damaging	Het
Afap1	C	A	5: 35,974,491	H387Q	probably damaging	Het
Atp8b1	C	T	18: 64,545,264	V854M	probably damaging	Het
Auts2	C	T	5: 131,487,463		probably benign	Het
Cbll1	T	C	12: 31,487,856	D300G	probably damaging	Het
Cd200r4	A	T	16: 44,833,049	T61S	possibly damaging	Het
Chmp4c	G	T	3: 10,389,684	V207L	probably benign	Het
Cntn5	T	C	9: 9,976,316	T413A	possibly damaging	Het
Cox7a2	T	A	9: 79,758,581		probably null	Het
Cwc27	A	G	13: 104,797,306	L236P	probably damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dst	T	A	1: 34,260,372		probably benign	Het
Ear1	T	A	14: 43,819,126	H95L	probably damaging	Het
Enpp1	T	A	10: 24,641,834	H898L	probably benign	Het
Entpd5	G	A	12: 84,382,295	R321*	probably null	Het
Ercc6l2	C	A	13: 63,824,871	N177K	possibly damaging	Het
Ergic1	T	C	17: 26,641,706		probably null	Het
Erich6	A	T	3: 58,626,598	I336N	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt3	A	T	2: 66,084,206	D622E	probably damaging	Het
Gjd4	T	A	18: 9,280,569	T170S	probably damaging	Het
Gm5611	G	A	9: 17,030,607		noncoding transcript	Het
Gpc5	T	A	14: 115,399,250	N448K	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Man2b2	T	C	5: 36,820,927	T338A	probably benign	Het
Mbtps1	A	T	8: 119,546,125	S94T	probably benign	Het
Muc3a	A	T	5: 137,210,081	S205T	unknown	Het
Nav2	C	A	7: 49,545,934	D1019E	probably damaging	Het
Neurl4	T	A	11: 69,903,426	L236*	probably null	Het
Olfr272	A	G	4: 52,911,260	V178A	probably benign	Het
Plcxd3	T	C	15: 4,516,611		probably benign	Het
Pprc1	T	C	19: 46,071,526		probably benign	Het
Prkaa2	T	A	4: 105,075,450	N67I	probably damaging	Het
Prom1	T	A	5: 44,018,353	Y508F	probably benign	Het
Prx	A	G	7: 27,517,258	M534V	probably damaging	Het
Rps6kc1	C	T	1: 190,871,768	R219Q	possibly damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Spata31	A	T	13: 64,921,382	Q448L	probably damaging	Het
Stk35	T	C	2: 129,811,235		probably benign	Het
Stxbp5	T	A	10: 9,838,092	R234S	probably damaging	Het
Tifab	A	G	13: 56,176,288	V114A	probably benign	Het
Tiprl	A	G	1: 165,228,406	M49T	probably benign	Het
Tlr12	A	G	4: 128,617,752	L235P	possibly damaging	Het
Tmem57	A	G	4: 134,804,507	V617A	probably damaging	Het
Trim43b	A	T	9: 89,085,358	C407*	probably null	Het
Txndc17	C	A	11: 72,207,707	F28L	probably damaging	Het
Vmn2r27	T	C	6: 124,200,690	R452G	probably damaging	Het
Vmn2r3	T	A	3: 64,275,117	D387V	probably damaging	Het
Vps13b	T	C	15: 35,875,566	I2699T	probably damaging	Het
Zfp944	G	T	17: 22,339,716	Y183*	probably null	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
R8773:Sbf2	UTSW	7	110348995	missense	probably benign
R8786:Sbf2	UTSW	7	110464586	critical splice donor site	probably null
R8812:Sbf2	UTSW	7	110329862	missense	probably damaging	1.00
R8876:Sbf2	UTSW	7	110449939	missense	probably damaging	0.99
R8932:Sbf2	UTSW	7	110440948	critical splice donor site	probably null
R8954:Sbf2	UTSW	7	110438911	nonsense	probably null
R8991:Sbf2	UTSW	7	110312689	missense	probably benign	0.20
R9119:Sbf2	UTSW	7	110312085	missense	possibly damaging	0.93
R9310:Sbf2	UTSW	7	110315085	missense	possibly damaging	0.58
R9344:Sbf2	UTSW	7	110341328	missense	probably benign	0.10
R9346:Sbf2	UTSW	7	110320739	missense	probably benign	0.05
R9404:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9406:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9408:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9472:Sbf2	UTSW	7	110371591	missense	possibly damaging	0.88
R9554:Sbf2	UTSW	7	110441464	missense	probably damaging	1.00
R9562:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9624:Sbf2	UTSW	7	110364650	missense	probably damaging	1.00
R9652:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9653:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9709:Sbf2	UTSW	7	110428307	missense	probably damaging	0.99
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAACATCTGCCTGAGCTTCCTTC -3'
(R):5'- GTACACCACCTTGTTCACACCAGAG -3'

Sequencing Primer
(F):5'- GAGCTTCCTTCAAGTCAATCCTAAG -3'
(R):5'- TGCAGTTGAACATGAATACAGTGC -3'

Posted On

2014-04-13