Mutagenetix > Incidental Mutation

Incidental Mutation 'R1536:Mbtps1'

169532

Institutional Source

Beutler Lab

Gene Symbol

Mbtps1

Ensembl Gene

ENSMUSG00000031835

Gene Name

membrane-bound transcription factor peptidase, site 1

Synonyms

subtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik

MMRRC Submission

039575-MU

Accession Numbers

ENSMUST00000098362; MGI: 1927235

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1536 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119508156-119558735 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119546125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 94 (S94T)

Ref Sequence

ENSEMBL: ENSMUSP00000095965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]

AlphaFold

Q9WTZ2

Predicted Effect

probably benign
Transcript: ENSMUST00000081381
AA Change: S94T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: S94T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	209	464	1.5e-43	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098362
AA Change: S94T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: S94T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S8	213	473	3.7e-45	PFAM
transmembrane domain	1000	1022	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212601

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212685

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212813

Meta Mutation Damage Score

0.0850

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,970,665	I3F	probably benign	Het
4930590J08Rik	A	G	6: 91,917,035	N211S	probably benign	Het
A2ml1	A	T	6: 128,547,233	Y1145*	probably null	Het
Abca7	A	G	10: 80,014,230	D1972G	probably benign	Het
Adamts19	A	T	18: 59,052,615	D1187V	probably damaging	Het
Adcy6	G	C	15: 98,600,007	I421M	probably damaging	Het
Afap1	C	A	5: 35,974,491	H387Q	probably damaging	Het
Atp8b1	C	T	18: 64,545,264	V854M	probably damaging	Het
Auts2	C	T	5: 131,487,463		probably benign	Het
Cbll1	T	C	12: 31,487,856	D300G	probably damaging	Het
Cd200r4	A	T	16: 44,833,049	T61S	possibly damaging	Het
Chmp4c	G	T	3: 10,389,684	V207L	probably benign	Het
Cntn5	T	C	9: 9,976,316	T413A	possibly damaging	Het
Cox7a2	T	A	9: 79,758,581		probably null	Het
Cwc27	A	G	13: 104,797,306	L236P	probably damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dst	T	A	1: 34,260,372		probably benign	Het
Ear1	T	A	14: 43,819,126	H95L	probably damaging	Het
Enpp1	T	A	10: 24,641,834	H898L	probably benign	Het
Entpd5	G	A	12: 84,382,295	R321*	probably null	Het
Ercc6l2	C	A	13: 63,824,871	N177K	possibly damaging	Het
Ergic1	T	C	17: 26,641,706		probably null	Het
Erich6	A	T	3: 58,626,598	I336N	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt3	A	T	2: 66,084,206	D622E	probably damaging	Het
Gjd4	T	A	18: 9,280,569	T170S	probably damaging	Het
Gm5611	G	A	9: 17,030,607		noncoding transcript	Het
Gpc5	T	A	14: 115,399,250	N448K	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Man2b2	T	C	5: 36,820,927	T338A	probably benign	Het
Muc3a	A	T	5: 137,210,081	S205T	unknown	Het
Nav2	C	A	7: 49,545,934	D1019E	probably damaging	Het
Neurl4	T	A	11: 69,903,426	L236*	probably null	Het
Olfr272	A	G	4: 52,911,260	V178A	probably benign	Het
Plcxd3	T	C	15: 4,516,611		probably benign	Het
Pprc1	T	C	19: 46,071,526		probably benign	Het
Prkaa2	T	A	4: 105,075,450	N67I	probably damaging	Het
Prom1	T	A	5: 44,018,353	Y508F	probably benign	Het
Prx	A	G	7: 27,517,258	M534V	probably damaging	Het
Rps6kc1	C	T	1: 190,871,768	R219Q	possibly damaging	Het
Sbf2	T	C	7: 110,378,043	Y628C	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Spata31	A	T	13: 64,921,382	Q448L	probably damaging	Het
Stk35	T	C	2: 129,811,235		probably benign	Het
Stxbp5	T	A	10: 9,838,092	R234S	probably damaging	Het
Tifab	A	G	13: 56,176,288	V114A	probably benign	Het
Tiprl	A	G	1: 165,228,406	M49T	probably benign	Het
Tlr12	A	G	4: 128,617,752	L235P	possibly damaging	Het
Tmem57	A	G	4: 134,804,507	V617A	probably damaging	Het
Trim43b	A	T	9: 89,085,358	C407*	probably null	Het
Txndc17	C	A	11: 72,207,707	F28L	probably damaging	Het
Vmn2r27	T	C	6: 124,200,690	R452G	probably damaging	Het
Vmn2r3	T	A	3: 64,275,117	D387V	probably damaging	Het
Vps13b	T	C	15: 35,875,566	I2699T	probably damaging	Het
Zfp944	G	T	17: 22,339,716	Y183*	probably null	Het

Other mutations in Mbtps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Muskrat	UTSW	8	119538137	missense	probably damaging	1.00
packrat	UTSW	8	119528961	missense	probably damaging	1.00
woodrat	UTSW	8	119529030	missense	probably damaging	1.00
R0194:Mbtps1	UTSW	8	119535369	missense	probably damaging	1.00
R0270:Mbtps1	UTSW	8	119538117	splice site	probably benign
R0485:Mbtps1	UTSW	8	119522601	splice site	probably benign
R1269:Mbtps1	UTSW	8	119520277	missense	probably damaging	1.00
R1351:Mbtps1	UTSW	8	119518162	missense	possibly damaging	0.95
R1542:Mbtps1	UTSW	8	119546247	splice site	probably null
R1543:Mbtps1	UTSW	8	119542069	splice site	probably benign
R1580:Mbtps1	UTSW	8	119538900	missense	possibly damaging	0.79
R1587:Mbtps1	UTSW	8	119518219	missense	probably damaging	0.96
R1715:Mbtps1	UTSW	8	119542730	missense	probably benign	0.40
R1845:Mbtps1	UTSW	8	119522493	missense	probably benign	0.13
R2147:Mbtps1	UTSW	8	119538859	missense	probably benign	0.01
R2157:Mbtps1	UTSW	8	119542727	missense	probably benign	0.01
R2416:Mbtps1	UTSW	8	119538917	missense	probably damaging	1.00
R2910:Mbtps1	UTSW	8	119546037	missense	possibly damaging	0.82
R2911:Mbtps1	UTSW	8	119546037	missense	possibly damaging	0.82
R3079:Mbtps1	UTSW	8	119531205	missense	probably benign	0.40
R3079:Mbtps1	UTSW	8	119538863	missense	probably damaging	1.00
R3080:Mbtps1	UTSW	8	119531205	missense	probably benign	0.40
R3080:Mbtps1	UTSW	8	119538863	missense	probably damaging	1.00
R4116:Mbtps1	UTSW	8	119541652	missense	probably benign	0.00
R4296:Mbtps1	UTSW	8	119522499	missense	possibly damaging	0.95
R4602:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4603:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4610:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4611:Mbtps1	UTSW	8	119535347	missense	probably damaging	1.00
R4729:Mbtps1	UTSW	8	119525420	missense	probably damaging	1.00
R4868:Mbtps1	UTSW	8	119508928	missense	probably benign	0.01
R4893:Mbtps1	UTSW	8	119518193	missense	probably damaging	1.00
R4999:Mbtps1	UTSW	8	119533348	missense	probably damaging	1.00
R6056:Mbtps1	UTSW	8	119515602	missense	probably benign
R6062:Mbtps1	UTSW	8	119531091	missense	possibly damaging	0.94
R6237:Mbtps1	UTSW	8	119528961	missense	probably damaging	1.00
R6617:Mbtps1	UTSW	8	119538137	missense	probably damaging	1.00
R7215:Mbtps1	UTSW	8	119524568	missense	possibly damaging	0.82
R7275:Mbtps1	UTSW	8	119542750	missense	probably benign
R7794:Mbtps1	UTSW	8	119538884	missense	probably damaging	1.00
R8029:Mbtps1	UTSW	8	119547805	start gained	probably benign
R8104:Mbtps1	UTSW	8	119529055	missense	possibly damaging	0.85
R8205:Mbtps1	UTSW	8	119520338	missense	probably damaging	1.00
R8351:Mbtps1	UTSW	8	119546184	missense	probably benign	0.01
R8487:Mbtps1	UTSW	8	119541674	missense	probably damaging	1.00
R8753:Mbtps1	UTSW	8	119508862	missense	possibly damaging	0.94
R9155:Mbtps1	UTSW	8	119508954	missense	probably benign	0.06
R9168:Mbtps1	UTSW	8	119521863	missense	probably benign	0.01
R9172:Mbtps1	UTSW	8	119533369	missense	probably damaging	1.00
R9621:Mbtps1	UTSW	8	119508882	missense	possibly damaging	0.69
RF019:Mbtps1	UTSW	8	119525550	missense	probably damaging	1.00
X0017:Mbtps1	UTSW	8	119531124	missense	probably damaging	1.00
X0027:Mbtps1	UTSW	8	119522547	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGTTCCCAAGTCCCTCTTAGC -3'
(R):5'- CGTGTGAATCTCTGCATGTTGCC -3'

Sequencing Primer
(F):5'- CGGCTCTGTAGTGAAAGGC -3'
(R):5'- TTCTCAATGGAGGTTCAGAGTAG -3'

Posted On

2014-04-13