Incidental Mutation 'R1536:Neurl4'
ID169540
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Nameneuralized E3 ubiquitin protein ligase 4
Synonyms0610025P10Rik
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1536 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69901072-69913820 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 69903426 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 236 (L236*)
Ref Sequence ENSEMBL: ENSMUSP00000135185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018714] [ENSMUST00000061837] [ENSMUST00000100969] [ENSMUST00000102580] [ENSMUST00000108617] [ENSMUST00000108621] [ENSMUST00000128046] [ENSMUST00000129234] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000144431] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000018714
SMART Domains Protein: ENSMUSP00000018714
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000061837
AA Change: L236*
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: L236*

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100969
SMART Domains Protein: ENSMUSP00000098529
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 272 5.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102580
SMART Domains Protein: ENSMUSP00000099640
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 153 270 6.2e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108617
AA Change: L236*
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: L236*

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108621
SMART Domains Protein: ENSMUSP00000104261
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128046
SMART Domains Protein: ENSMUSP00000137547
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
Pfam:IPP-2 1 77 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129234
SMART Domains Protein: ENSMUSP00000136835
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000133203
AA Change: L12*
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284
AA Change: L12*

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142121
Predicted Effect probably benign
Transcript: ENSMUST00000144431
SMART Domains Protein: ENSMUSP00000135926
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176614
Predicted Effect probably null
Transcript: ENSMUST00000177138
AA Change: L236*
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: L236*

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177160
Predicted Effect probably null
Transcript: ENSMUST00000177476
AA Change: L236*
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: L236*

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69904587 missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69910393 missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69907099 missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69909623 missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69905790 missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69910340 missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69906335 missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69906831 missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69909065 missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69910406 missense probably benign 0.41
R0388:Neurl4 UTSW 11 69911733 splice site probably benign
R0421:Neurl4 UTSW 11 69908534 missense probably damaging 1.00
R0449:Neurl4 UTSW 11 69905567 missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69903721 critical splice donor site probably null
R1345:Neurl4 UTSW 11 69903876 missense probably benign 0.21
R1642:Neurl4 UTSW 11 69903659 missense probably benign 0.03
R1857:Neurl4 UTSW 11 69905535 missense probably damaging 1.00
R1935:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69903210 missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69909292 missense probably benign
R2046:Neurl4 UTSW 11 69908697 missense probably damaging 1.00
R2165:Neurl4 UTSW 11 69903221 missense probably benign
R2393:Neurl4 UTSW 11 69907074 missense probably damaging 1.00
R3810:Neurl4 UTSW 11 69904033 missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69909061 missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69911068 missense probably benign 0.00
R4898:Neurl4 UTSW 11 69903171 missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69907308 missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69911087 missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69906368 missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69910916 critical splice donor site probably null
R6791:Neurl4 UTSW 11 69908510 missense probably damaging 1.00
R7029:Neurl4 UTSW 11 69910736 missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69910262 missense probably damaging 1.00
R7361:Neurl4 UTSW 11 69912079 missense probably benign 0.01
R7367:Neurl4 UTSW 11 69908582 missense probably damaging 1.00
R7804:Neurl4 UTSW 11 69905874 missense probably benign 0.00
R7871:Neurl4 UTSW 11 69903186 missense probably benign
R7954:Neurl4 UTSW 11 69903186 missense probably benign
X0025:Neurl4 UTSW 11 69906801 missense probably damaging 1.00
Z1177:Neurl4 UTSW 11 69904090 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GTGGCTCCATTGAGATTGGAGTGAC -3'
(R):5'- AGGGGAATAGGGTTCAGCTCATGC -3'

Sequencing Primer
(F):5'- TGGACCAGCTTGTCGAAG -3'
(R):5'- AATAGGGTTCAGCTCATGCTTCAG -3'
Posted On2014-04-13