Incidental Mutation 'R1536:Cbll1'
ID169542
Institutional Source Beutler Lab
Gene Symbol Cbll1
Ensembl Gene ENSMUSG00000020659
Gene NameCasitas B-lineage lymphoma-like 1
Synonymsc-Cbl-like, Hakai
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R1536 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31484829-31499616 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31487856 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 300 (D300G)
Ref Sequence ENSEMBL: ENSMUSP00000082616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064240] [ENSMUST00000085487] [ENSMUST00000101499] [ENSMUST00000185739] [ENSMUST00000188326]
Predicted Effect probably damaging
Transcript: ENSMUST00000064240
AA Change: D297G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063266
Gene: ENSMUSG00000020659
AA Change: D297G

DomainStartEndE-ValueType
RING 105 144 1.08e-1 SMART
ZnF_C2H2 160 186 5.92e0 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 292 315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085487
AA Change: D300G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082616
Gene: ENSMUSG00000020659
AA Change: D300G

DomainStartEndE-ValueType
RING 109 148 1.08e-1 SMART
ZnF_C2H2 164 190 5.92e0 SMART
low complexity region 207 218 N/A INTRINSIC
low complexity region 231 244 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 308 325 N/A INTRINSIC
low complexity region 376 399 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101499
AA Change: D300G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099038
Gene: ENSMUSG00000020659
AA Change: D300G

DomainStartEndE-ValueType
RING 109 148 5.3e-4 SMART
ZnF_C2H2 164 190 2.5e-2 SMART
low complexity region 207 218 N/A INTRINSIC
low complexity region 231 244 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
low complexity region 308 320 N/A INTRINSIC
low complexity region 336 360 N/A INTRINSIC
low complexity region 372 388 N/A INTRINSIC
low complexity region 393 426 N/A INTRINSIC
low complexity region 451 474 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185739
AA Change: D299G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141007
Gene: ENSMUSG00000020659
AA Change: D299G

DomainStartEndE-ValueType
RING 108 147 5.2e-4 SMART
ZnF_C2H2 163 189 2.5e-2 SMART
low complexity region 206 217 N/A INTRINSIC
low complexity region 230 243 N/A INTRINSIC
low complexity region 261 273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186876
Predicted Effect probably benign
Transcript: ENSMUST00000188326
SMART Domains Protein: ENSMUSP00000139809
Gene: ENSMUSG00000020659

DomainStartEndE-ValueType
RING 106 145 5.2e-4 SMART
ZnF_C2H2 161 187 2.5e-2 SMART
low complexity region 204 215 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
Meta Mutation Damage Score 0.1591 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-ligase for the E-cadherin complex and mediates its ubiquitination, endocytosis, and degradation in the lysosomes. The encoded protein contains a RING-finger domain and is also thought to have a role in control of cell proliferation. A related pseudogene has been identified on chromosome X. Alternative splicing results in a non-coding transcript variant. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Cbll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Cbll1 APN 12 31487833 missense probably damaging 0.99
IGL00540:Cbll1 APN 12 31487941 missense probably damaging 1.00
IGL02988:Cbll1 UTSW 12 31492172 missense possibly damaging 0.86
R0398:Cbll1 UTSW 12 31492092 missense probably damaging 0.99
R0573:Cbll1 UTSW 12 31490540 missense probably damaging 1.00
R5102:Cbll1 UTSW 12 31487913 missense probably damaging 1.00
R6267:Cbll1 UTSW 12 31487508 missense probably benign 0.00
R6296:Cbll1 UTSW 12 31487508 missense probably benign 0.00
R6304:Cbll1 UTSW 12 31494589 critical splice donor site probably null
R6882:Cbll1 UTSW 12 31487485 missense probably damaging 1.00
R7751:Cbll1 UTSW 12 31487580 missense probably damaging 0.99
X0028:Cbll1 UTSW 12 31488309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGGCCATATACCAGGACTCATTC -3'
(R):5'- TGAGCCATATTCCTCCAAAGCAGC -3'

Sequencing Primer
(F):5'- CTATATACCAAGTGAGGAGTACCTGC -3'
(R):5'- ATGATGCCACCGCCTCC -3'
Posted On2014-04-13