Incidental Mutation 'R1536:Entpd5'
ID169543
Institutional Source Beutler Lab
Gene Symbol Entpd5
Ensembl Gene ENSMUSG00000021236
Gene Nameectonucleoside triphosphate diphosphohydrolase 5
SynonymsER-UDPase, Cd39l4, NTPDase-5, Pcph, NTPDase5, mNTPase
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1536 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84373857-84409029 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 84382295 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 321 (R321*)
Ref Sequence ENSEMBL: ENSMUSP00000113106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021662] [ENSMUST00000072061] [ENSMUST00000110272] [ENSMUST00000117286] [ENSMUST00000120942] [ENSMUST00000122194]
Predicted Effect probably null
Transcript: ENSMUST00000021662
AA Change: R321*
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072061
AA Change: R346*
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236
AA Change: R346*

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110272
AA Change: R321*
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117286
AA Change: R321*
SMART Domains Protein: ENSMUSP00000114011
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120942
AA Change: R321*
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122194
AA Change: R321*
SMART Domains Protein: ENSMUSP00000113106
Gene: ENSMUSG00000021236
AA Change: R321*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135061
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to E-type nucleotidases (NTPases)/ecto-ATPase/apyrases. NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD5 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele develop progressive hepatopathy, hepatocellular tumors, and spermatogenic arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Entpd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Entpd5 APN 12 84387054 missense probably damaging 1.00
IGL01455:Entpd5 APN 12 84394677 missense probably benign 0.00
IGL02168:Entpd5 APN 12 84386978 critical splice donor site probably null
IGL02183:Entpd5 APN 12 84380380 splice site probably benign
IGL03104:Entpd5 APN 12 84384248 missense probably damaging 0.97
IGL03332:Entpd5 APN 12 84382228 splice site probably null
aventi UTSW 12 84382295 nonsense probably null
eatsy UTSW 12 84382295 nonsense probably null
magenschonend UTSW 12 84394690 missense probably benign 0.00
R0024:Entpd5 UTSW 12 84373733 missense probably benign 0.01
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0644:Entpd5 UTSW 12 84386141 missense probably benign 0.00
R1533:Entpd5 UTSW 12 84394660 missense probably damaging 1.00
R1740:Entpd5 UTSW 12 84396771 missense probably benign 0.01
R1768:Entpd5 UTSW 12 84386211 missense probably benign
R2049:Entpd5 UTSW 12 84396858 missense probably benign 0.00
R5128:Entpd5 UTSW 12 84394690 missense probably benign 0.00
R6562:Entpd5 UTSW 12 84386200 missense probably damaging 1.00
R6907:Entpd5 UTSW 12 84377353 missense probably benign 0.23
R7209:Entpd5 UTSW 12 84396928 missense probably benign
R7605:Entpd5 UTSW 12 84396708 missense probably damaging 1.00
X0057:Entpd5 UTSW 12 84384220 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCTACTGGGAAAGAACTGGGAAGCC -3'
(R):5'- TCAGATTGCCCTGCTGTTTCAGAG -3'

Sequencing Primer
(F):5'- TGGGAAGCCACTGCAAC -3'
(R):5'- ACTGCTGCTCAGAGGCTAAG -3'
Posted On2014-04-13