Incidental Mutation 'R1536:Plcxd3'
ID169550
Institutional Source Beutler Lab
Gene Symbol Plcxd3
Ensembl Gene ENSMUSG00000049148
Gene Namephosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1536 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4375491-4575553 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 4516611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061925] [ENSMUST00000130332]
Predicted Effect probably benign
Transcript: ENSMUST00000061925
SMART Domains Protein: ENSMUSP00000053553
Gene: ENSMUSG00000049148

DomainStartEndE-ValueType
SCOP:d2ptd__ 2 311 2e-62 SMART
PDB:1AOD|A 7 166 1e-8 PDB
Blast:PLCXc 23 148 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130332
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Adcy6 G C 15: 98,600,007 I421M probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Plcxd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Plcxd3 APN 15 4516640 missense possibly damaging 0.91
IGL02743:Plcxd3 APN 15 4574803 missense possibly damaging 0.92
IGL03230:Plcxd3 APN 15 4516790 missense probably damaging 0.99
R0599:Plcxd3 UTSW 15 4516867 missense probably damaging 0.96
R0724:Plcxd3 UTSW 15 4516868 missense probably damaging 0.99
R0939:Plcxd3 UTSW 15 4516862 nonsense probably null
R1648:Plcxd3 UTSW 15 4375809 missense probably benign
R1858:Plcxd3 UTSW 15 4516611 splice site probably benign
R2418:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R2419:Plcxd3 UTSW 15 4574763 missense probably benign 0.04
R4640:Plcxd3 UTSW 15 4517243 missense probably damaging 0.99
R4702:Plcxd3 UTSW 15 4375787 missense probably benign
R5372:Plcxd3 UTSW 15 4574788 missense probably benign
R5705:Plcxd3 UTSW 15 4517194 missense probably benign 0.43
R6302:Plcxd3 UTSW 15 4516757 missense probably damaging 1.00
R7050:Plcxd3 UTSW 15 4516718 missense probably damaging 0.96
R7283:Plcxd3 UTSW 15 4516919 missense probably damaging 0.97
R7856:Plcxd3 UTSW 15 4517099 missense probably damaging 0.98
R8233:Plcxd3 UTSW 15 4516835 missense possibly damaging 0.77
R8272:Plcxd3 UTSW 15 4516736 missense probably damaging 0.99
R8782:Plcxd3 UTSW 15 4516768 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AGTTTGCTTGACACATTTGAGGG -3'
(R):5'- TTTGTGGTGGTCTGTGAGAAATG -3'

Sequencing Primer
(F):5'- TGACACATTTGAGGGGAAAG -3'
(R):5'- TGCATTGATCTCTTCGAGAC -3'
Posted On2014-04-13