Incidental Mutation 'R1536:Adcy6'
ID169552
Institutional Source Beutler Lab
Gene Symbol Adcy6
Ensembl Gene ENSMUSG00000022994
Gene Nameadenylate cyclase 6
Synonyms
MMRRC Submission 039575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1536 (G1)
Quality Score173
Status Validated
Chromosome15
Chromosomal Location98589973-98610076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 98600007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 421 (I421M)
Ref Sequence ENSEMBL: ENSMUSP00000154696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096224] [ENSMUST00000226500] [ENSMUST00000227501] [ENSMUST00000228566] [ENSMUST00000228903]
Predicted Effect probably damaging
Transcript: ENSMUST00000096224
AA Change: I423M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994
AA Change: I423M

DomainStartEndE-ValueType
low complexity region 150 166 N/A INTRINSIC
low complexity region 169 177 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
CYCc 331 532 2.95e-63 SMART
Pfam:DUF1053 580 669 3.5e-18 PFAM
transmembrane domain 701 723 N/A INTRINSIC
transmembrane domain 744 763 N/A INTRINSIC
transmembrane domain 815 834 N/A INTRINSIC
transmembrane domain 839 861 N/A INTRINSIC
Blast:CYCc 885 929 5e-20 BLAST
CYCc 939 1147 4.81e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226236
Predicted Effect probably benign
Transcript: ENSMUST00000226500
Predicted Effect probably benign
Transcript: ENSMUST00000227501
Predicted Effect probably damaging
Transcript: ENSMUST00000228566
AA Change: I421M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228903
AA Change: I421M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5669 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,665 I3F probably benign Het
4930590J08Rik A G 6: 91,917,035 N211S probably benign Het
A2ml1 A T 6: 128,547,233 Y1145* probably null Het
Abca7 A G 10: 80,014,230 D1972G probably benign Het
Adamts19 A T 18: 59,052,615 D1187V probably damaging Het
Afap1 C A 5: 35,974,491 H387Q probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Auts2 C T 5: 131,487,463 probably benign Het
Cbll1 T C 12: 31,487,856 D300G probably damaging Het
Cd200r4 A T 16: 44,833,049 T61S possibly damaging Het
Chmp4c G T 3: 10,389,684 V207L probably benign Het
Cntn5 T C 9: 9,976,316 T413A possibly damaging Het
Cox7a2 T A 9: 79,758,581 probably null Het
Cwc27 A G 13: 104,797,306 L236P probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dst T A 1: 34,260,372 probably benign Het
Ear1 T A 14: 43,819,126 H95L probably damaging Het
Enpp1 T A 10: 24,641,834 H898L probably benign Het
Entpd5 G A 12: 84,382,295 R321* probably null Het
Ercc6l2 C A 13: 63,824,871 N177K possibly damaging Het
Ergic1 T C 17: 26,641,706 probably null Het
Erich6 A T 3: 58,626,598 I336N probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galnt3 A T 2: 66,084,206 D622E probably damaging Het
Gjd4 T A 18: 9,280,569 T170S probably damaging Het
Gm5611 G A 9: 17,030,607 noncoding transcript Het
Gpc5 T A 14: 115,399,250 N448K probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Man2b2 T C 5: 36,820,927 T338A probably benign Het
Mbtps1 A T 8: 119,546,125 S94T probably benign Het
Muc3a A T 5: 137,210,081 S205T unknown Het
Nav2 C A 7: 49,545,934 D1019E probably damaging Het
Neurl4 T A 11: 69,903,426 L236* probably null Het
Olfr272 A G 4: 52,911,260 V178A probably benign Het
Plcxd3 T C 15: 4,516,611 probably benign Het
Pprc1 T C 19: 46,071,526 probably benign Het
Prkaa2 T A 4: 105,075,450 N67I probably damaging Het
Prom1 T A 5: 44,018,353 Y508F probably benign Het
Prx A G 7: 27,517,258 M534V probably damaging Het
Rps6kc1 C T 1: 190,871,768 R219Q possibly damaging Het
Sbf2 T C 7: 110,378,043 Y628C probably damaging Het
Slc1a2 A T 2: 102,777,510 D501V probably benign Het
Spata31 A T 13: 64,921,382 Q448L probably damaging Het
Stk35 T C 2: 129,811,235 probably benign Het
Stxbp5 T A 10: 9,838,092 R234S probably damaging Het
Tifab A G 13: 56,176,288 V114A probably benign Het
Tiprl A G 1: 165,228,406 M49T probably benign Het
Tlr12 A G 4: 128,617,752 L235P possibly damaging Het
Tmem57 A G 4: 134,804,507 V617A probably damaging Het
Trim43b A T 9: 89,085,358 C407* probably null Het
Txndc17 C A 11: 72,207,707 F28L probably damaging Het
Vmn2r27 T C 6: 124,200,690 R452G probably damaging Het
Vmn2r3 T A 3: 64,275,117 D387V probably damaging Het
Vps13b T C 15: 35,875,566 I2699T probably damaging Het
Zfp944 G T 17: 22,339,716 Y183* probably null Het
Other mutations in Adcy6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Adcy6 APN 15 98598976 missense probably damaging 1.00
IGL01132:Adcy6 APN 15 98597851 missense probably benign 0.14
IGL01642:Adcy6 APN 15 98594509 missense possibly damaging 0.88
IGL01647:Adcy6 APN 15 98600275 missense probably damaging 1.00
IGL01788:Adcy6 APN 15 98596519 nonsense probably null
IGL02122:Adcy6 APN 15 98598882 missense possibly damaging 0.66
IGL02210:Adcy6 APN 15 98594971 missense possibly damaging 0.63
IGL02249:Adcy6 APN 15 98599914 missense probably damaging 1.00
IGL02404:Adcy6 APN 15 98596938 missense probably benign
IGL02691:Adcy6 APN 15 98604304 missense probably damaging 1.00
PIT4515001:Adcy6 UTSW 15 98595146 missense probably benign 0.04
R0178:Adcy6 UTSW 15 98604215 missense probably benign 0.00
R0497:Adcy6 UTSW 15 98597725 critical splice donor site probably null
R0739:Adcy6 UTSW 15 98598379 missense probably benign 0.00
R1454:Adcy6 UTSW 15 98604728 missense probably damaging 1.00
R1473:Adcy6 UTSW 15 98592743 missense probably damaging 0.99
R1927:Adcy6 UTSW 15 98598498 splice site probably null
R2178:Adcy6 UTSW 15 98594355 missense probably damaging 1.00
R2294:Adcy6 UTSW 15 98597441 missense possibly damaging 0.48
R2356:Adcy6 UTSW 15 98597016 splice site probably null
R2898:Adcy6 UTSW 15 98593488 missense probably damaging 1.00
R3001:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3002:Adcy6 UTSW 15 98596660 missense probably benign 0.01
R3794:Adcy6 UTSW 15 98598943 missense probably damaging 1.00
R3884:Adcy6 UTSW 15 98597174 missense probably benign 0.06
R4348:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4351:Adcy6 UTSW 15 98604160 missense probably benign 0.44
R4542:Adcy6 UTSW 15 98598988 missense possibly damaging 0.70
R4548:Adcy6 UTSW 15 98598659 missense probably damaging 1.00
R5693:Adcy6 UTSW 15 98603989 missense probably damaging 1.00
R5707:Adcy6 UTSW 15 98598741 missense probably damaging 1.00
R5994:Adcy6 UTSW 15 98593664 missense probably damaging 1.00
R5998:Adcy6 UTSW 15 98594354 nonsense probably null
R6142:Adcy6 UTSW 15 98598422 missense probably benign
R6242:Adcy6 UTSW 15 98604015 nonsense probably null
R6305:Adcy6 UTSW 15 98598645 missense probably benign 0.13
R6751:Adcy6 UTSW 15 98596205 missense probably benign
R7130:Adcy6 UTSW 15 98597229 missense probably benign
R7335:Adcy6 UTSW 15 98603876 missense probably benign 0.29
R7643:Adcy6 UTSW 15 98593568 missense probably benign
R7658:Adcy6 UTSW 15 98596067 missense probably benign 0.00
R7748:Adcy6 UTSW 15 98604556 missense probably benign 0.01
R7761:Adcy6 UTSW 15 98600014 missense probably damaging 1.00
R7774:Adcy6 UTSW 15 98596533 missense probably benign
X0020:Adcy6 UTSW 15 98598735 missense probably damaging 0.99
X0021:Adcy6 UTSW 15 98603942 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACGTCCCGAAGACACATCAGAGTG -3'
(R):5'- TTGCGGACATTGAGGGCTTCAC -3'

Sequencing Primer
(F):5'- ACATCAGAGTGGGAGCCTC -3'
(R):5'- TGCACTGCACAGGAACTG -3'
Posted On2014-04-13