Mutagenetix > Incidental Mutation

Incidental Mutation 'R1536:Adamts19'

169559

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

039575-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1536 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59052615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1187 (D1187V)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

probably damaging
Transcript: ENSMUST00000052907
AA Change: D1187V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: D1187V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.5307

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,970,665	I3F	probably benign	Het
4930590J08Rik	A	G	6: 91,917,035	N211S	probably benign	Het
A2ml1	A	T	6: 128,547,233	Y1145*	probably null	Het
Abca7	A	G	10: 80,014,230	D1972G	probably benign	Het
Adcy6	G	C	15: 98,600,007	I421M	probably damaging	Het
Afap1	C	A	5: 35,974,491	H387Q	probably damaging	Het
Atp8b1	C	T	18: 64,545,264	V854M	probably damaging	Het
Auts2	C	T	5: 131,487,463		probably benign	Het
Cbll1	T	C	12: 31,487,856	D300G	probably damaging	Het
Cd200r4	A	T	16: 44,833,049	T61S	possibly damaging	Het
Chmp4c	G	T	3: 10,389,684	V207L	probably benign	Het
Cntn5	T	C	9: 9,976,316	T413A	possibly damaging	Het
Cox7a2	T	A	9: 79,758,581		probably null	Het
Cwc27	A	G	13: 104,797,306	L236P	probably damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dst	T	A	1: 34,260,372		probably benign	Het
Ear1	T	A	14: 43,819,126	H95L	probably damaging	Het
Enpp1	T	A	10: 24,641,834	H898L	probably benign	Het
Entpd5	G	A	12: 84,382,295	R321*	probably null	Het
Ercc6l2	C	A	13: 63,824,871	N177K	possibly damaging	Het
Ergic1	T	C	17: 26,641,706		probably null	Het
Erich6	A	T	3: 58,626,598	I336N	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galnt3	A	T	2: 66,084,206	D622E	probably damaging	Het
Gjd4	T	A	18: 9,280,569	T170S	probably damaging	Het
Gm5611	G	A	9: 17,030,607		noncoding transcript	Het
Gpc5	T	A	14: 115,399,250	N448K	probably benign	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Man2b2	T	C	5: 36,820,927	T338A	probably benign	Het
Mbtps1	A	T	8: 119,546,125	S94T	probably benign	Het
Muc3a	A	T	5: 137,210,081	S205T	unknown	Het
Nav2	C	A	7: 49,545,934	D1019E	probably damaging	Het
Neurl4	T	A	11: 69,903,426	L236*	probably null	Het
Olfr272	A	G	4: 52,911,260	V178A	probably benign	Het
Plcxd3	T	C	15: 4,516,611		probably benign	Het
Pprc1	T	C	19: 46,071,526		probably benign	Het
Prkaa2	T	A	4: 105,075,450	N67I	probably damaging	Het
Prom1	T	A	5: 44,018,353	Y508F	probably benign	Het
Prx	A	G	7: 27,517,258	M534V	probably damaging	Het
Rps6kc1	C	T	1: 190,871,768	R219Q	possibly damaging	Het
Sbf2	T	C	7: 110,378,043	Y628C	probably damaging	Het
Slc1a2	A	T	2: 102,777,510	D501V	probably benign	Het
Spata31	A	T	13: 64,921,382	Q448L	probably damaging	Het
Stk35	T	C	2: 129,811,235		probably benign	Het
Stxbp5	T	A	10: 9,838,092	R234S	probably damaging	Het
Tifab	A	G	13: 56,176,288	V114A	probably benign	Het
Tiprl	A	G	1: 165,228,406	M49T	probably benign	Het
Tlr12	A	G	4: 128,617,752	L235P	possibly damaging	Het
Tmem57	A	G	4: 134,804,507	V617A	probably damaging	Het
Trim43b	A	T	9: 89,085,358	C407*	probably null	Het
Txndc17	C	A	11: 72,207,707	F28L	probably damaging	Het
Vmn2r27	T	C	6: 124,200,690	R452G	probably damaging	Het
Vmn2r3	T	A	3: 64,275,117	D387V	probably damaging	Het
Vps13b	T	C	15: 35,875,566	I2699T	probably damaging	Het
Zfp944	G	T	17: 22,339,716	Y183*	probably null	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5116:Adamts19	UTSW	18	58902994	missense	possibly damaging	0.52
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- TGCTCCTACTGATGATACCTATGCACC -3'
(R):5'- GCACCTTAGAGACAGCCCTCAATG -3'

Sequencing Primer
(F):5'- TGATGATACCTATGCACCTCCAC -3'
(R):5'- CTGTCAGAGGTCAACTCTTCTG -3'

Posted On

2014-04-13