Incidental Mutation 'R1536:Adamts19'
ID 169559
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 19
Synonyms D230034E10Rik
MMRRC Submission 039575-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1536 (G1)
Quality Score 219
Status Validated
Chromosome 18
Chromosomal Location 58969739-59187132 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59185687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1187 (D1187V)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
AlphaFold P59509
Predicted Effect probably damaging
Transcript: ENSMUST00000052907
AA Change: D1187V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: D1187V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Meta Mutation Damage Score 0.5307 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,118,524 (GRCm39) I3F probably benign Het
4930590J08Rik A G 6: 91,894,016 (GRCm39) N211S probably benign Het
A2ml1 A T 6: 128,524,196 (GRCm39) Y1145* probably null Het
Abca7 A G 10: 79,850,064 (GRCm39) D1972G probably benign Het
Adcy6 G C 15: 98,497,888 (GRCm39) I421M probably damaging Het
Afap1 C A 5: 36,131,835 (GRCm39) H387Q probably damaging Het
Atp8b1 C T 18: 64,678,335 (GRCm39) V854M probably damaging Het
Auts2 C T 5: 131,516,302 (GRCm39) probably benign Het
Cbll1 T C 12: 31,537,855 (GRCm39) D300G probably damaging Het
Cd200r4 A T 16: 44,653,412 (GRCm39) T61S possibly damaging Het
Chmp4c G T 3: 10,454,744 (GRCm39) V207L probably benign Het
Cntn5 T C 9: 9,976,321 (GRCm39) T413A possibly damaging Het
Cox7a2 T A 9: 79,665,863 (GRCm39) probably null Het
Cwc27 A G 13: 104,933,814 (GRCm39) L236P probably damaging Het
Diaph1 A G 18: 38,029,146 (GRCm39) probably null Het
Dst T A 1: 34,299,453 (GRCm39) probably benign Het
Ear1 T A 14: 44,056,583 (GRCm39) H95L probably damaging Het
Enpp1 T A 10: 24,517,732 (GRCm39) H898L probably benign Het
Entpd5 G A 12: 84,429,069 (GRCm39) R321* probably null Het
Ercc6l2 C A 13: 63,972,685 (GRCm39) N177K possibly damaging Het
Ergic1 T C 17: 26,860,680 (GRCm39) probably null Het
Erich6 A T 3: 58,534,019 (GRCm39) I336N probably benign Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Galnt3 A T 2: 65,914,550 (GRCm39) D622E probably damaging Het
Gjd4 T A 18: 9,280,569 (GRCm39) T170S probably damaging Het
Gm5611 G A 9: 16,941,903 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 115,636,662 (GRCm39) N448K probably benign Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Maco1 A G 4: 134,531,818 (GRCm39) V617A probably damaging Het
Man2b2 T C 5: 36,978,271 (GRCm39) T338A probably benign Het
Mbtps1 A T 8: 120,272,864 (GRCm39) S94T probably benign Het
Muc3a A T 5: 137,244,538 (GRCm39) S205T unknown Het
Nav2 C A 7: 49,195,682 (GRCm39) D1019E probably damaging Het
Neurl4 T A 11: 69,794,252 (GRCm39) L236* probably null Het
Or13c25 A G 4: 52,911,260 (GRCm39) V178A probably benign Het
Plcxd3 T C 15: 4,546,093 (GRCm39) probably benign Het
Pprc1 T C 19: 46,059,965 (GRCm39) probably benign Het
Prkaa2 T A 4: 104,932,647 (GRCm39) N67I probably damaging Het
Prom1 T A 5: 44,175,695 (GRCm39) Y508F probably benign Het
Prx A G 7: 27,216,683 (GRCm39) M534V probably damaging Het
Rps6kc1 C T 1: 190,603,965 (GRCm39) R219Q possibly damaging Het
Sbf2 T C 7: 109,977,250 (GRCm39) Y628C probably damaging Het
Slc1a2 A T 2: 102,607,855 (GRCm39) D501V probably benign Het
Spata31 A T 13: 65,069,196 (GRCm39) Q448L probably damaging Het
Stk35 T C 2: 129,653,155 (GRCm39) probably benign Het
Stxbp5 T A 10: 9,713,836 (GRCm39) R234S probably damaging Het
Tifab A G 13: 56,324,101 (GRCm39) V114A probably benign Het
Tiprl A G 1: 165,055,975 (GRCm39) M49T probably benign Het
Tlr12 A G 4: 128,511,545 (GRCm39) L235P possibly damaging Het
Trim43b A T 9: 88,967,411 (GRCm39) C407* probably null Het
Txndc17 C A 11: 72,098,533 (GRCm39) F28L probably damaging Het
Vmn2r27 T C 6: 124,177,649 (GRCm39) R452G probably damaging Het
Vmn2r3 T A 3: 64,182,538 (GRCm39) D387V probably damaging Het
Vps13b T C 15: 35,875,712 (GRCm39) I2699T probably damaging Het
Zfp944 G T 17: 22,558,697 (GRCm39) Y183* probably null Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59,157,537 (GRCm39) missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59,140,397 (GRCm39) splice site probably benign
IGL00970:Adamts19 APN 18 59,144,149 (GRCm39) missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59,181,954 (GRCm39) missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 59,105,851 (GRCm39) missense probably damaging 0.98
IGL01529:Adamts19 APN 18 59,096,535 (GRCm39) missense probably damaging 0.99
IGL01535:Adamts19 APN 18 59,101,891 (GRCm39) missense probably benign 0.00
IGL01557:Adamts19 APN 18 59,101,792 (GRCm39) splice site probably null
IGL01705:Adamts19 APN 18 59,166,038 (GRCm39) missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 59,085,541 (GRCm39) missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58,970,571 (GRCm39) missense probably benign
IGL02131:Adamts19 APN 18 59,185,732 (GRCm39) missense probably damaging 1.00
IGL02312:Adamts19 APN 18 59,060,369 (GRCm39) missense probably damaging 1.00
IGL02755:Adamts19 APN 18 59,103,005 (GRCm39) missense probably benign 0.25
IGL02866:Adamts19 APN 18 59,181,914 (GRCm39) missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 59,122,037 (GRCm39) missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59,157,590 (GRCm39) missense probably damaging 1.00
IGL03040:Adamts19 APN 18 59,036,080 (GRCm39) missense probably benign 0.05
R0081:Adamts19 UTSW 18 59,036,137 (GRCm39) critical splice donor site probably null
R0194:Adamts19 UTSW 18 59,144,220 (GRCm39) missense probably null 1.00
R0195:Adamts19 UTSW 18 59,102,942 (GRCm39) splice site probably benign
R0541:Adamts19 UTSW 18 59,060,372 (GRCm39) critical splice donor site probably null
R0659:Adamts19 UTSW 18 59,140,565 (GRCm39) splice site probably benign
R0967:Adamts19 UTSW 18 59,105,812 (GRCm39) nonsense probably null
R1512:Adamts19 UTSW 18 59,181,917 (GRCm39) missense possibly damaging 0.89
R1582:Adamts19 UTSW 18 59,103,013 (GRCm39) missense probably damaging 0.98
R1629:Adamts19 UTSW 18 59,087,691 (GRCm39) missense probably damaging 0.97
R1653:Adamts19 UTSW 18 59,023,365 (GRCm39) missense probably benign 0.00
R1718:Adamts19 UTSW 18 59,105,897 (GRCm39) missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59,165,001 (GRCm39) missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 59,087,692 (GRCm39) missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59,166,017 (GRCm39) missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 59,103,078 (GRCm39) missense probably benign 0.09
R1994:Adamts19 UTSW 18 59,105,903 (GRCm39) critical splice donor site probably null
R2177:Adamts19 UTSW 18 59,087,626 (GRCm39) missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 59,033,982 (GRCm39) missense probably damaging 1.00
R4342:Adamts19 UTSW 18 59,075,572 (GRCm39) missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58,970,848 (GRCm39) missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 59,023,356 (GRCm39) missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59,166,072 (GRCm39) missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59,164,876 (GRCm39) nonsense probably null
R5116:Adamts19 UTSW 18 59,036,066 (GRCm39) missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 59,101,880 (GRCm39) missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59,185,654 (GRCm39) missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58,971,040 (GRCm39) missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58,970,584 (GRCm39) missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 59,101,846 (GRCm39) missense probably benign 0.18
R6088:Adamts19 UTSW 18 59,035,174 (GRCm39) missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58,970,712 (GRCm39) nonsense probably null
R7251:Adamts19 UTSW 18 58,970,974 (GRCm39) missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58,970,955 (GRCm39) missense probably damaging 1.00
R7974:Adamts19 UTSW 18 59,144,094 (GRCm39) missense possibly damaging 0.72
R7991:Adamts19 UTSW 18 59,185,726 (GRCm39) missense probably damaging 1.00
R8129:Adamts19 UTSW 18 59,140,559 (GRCm39) critical splice donor site probably null
R8297:Adamts19 UTSW 18 58,970,920 (GRCm39) missense probably damaging 1.00
R8336:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R8358:Adamts19 UTSW 18 59,181,881 (GRCm39) missense probably damaging 1.00
R8864:Adamts19 UTSW 18 59,023,497 (GRCm39) nonsense probably null
R9051:Adamts19 UTSW 18 59,034,048 (GRCm39) missense probably damaging 1.00
R9253:Adamts19 UTSW 18 59,103,013 (GRCm39) missense probably damaging 0.98
R9423:Adamts19 UTSW 18 59,023,427 (GRCm39) missense possibly damaging 0.89
R9610:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9611:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9686:Adamts19 UTSW 18 58,971,093 (GRCm39) missense probably benign 0.00
R9697:Adamts19 UTSW 18 59,101,834 (GRCm39) missense probably damaging 0.99
R9747:Adamts19 UTSW 18 59,023,487 (GRCm39) missense possibly damaging 0.69
Z1177:Adamts19 UTSW 18 59,023,446 (GRCm39) missense possibly damaging 0.47
Z1177:Adamts19 UTSW 18 58,971,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCCTACTGATGATACCTATGCACC -3'
(R):5'- GCACCTTAGAGACAGCCCTCAATG -3'

Sequencing Primer
(F):5'- TGATGATACCTATGCACCTCCAC -3'
(R):5'- CTGTCAGAGGTCAACTCTTCTG -3'
Posted On 2014-04-13