Incidental Mutation 'R1537:Bmpr2'
ID169563
Institutional Source Beutler Lab
Gene Symbol Bmpr2
Ensembl Gene ENSMUSG00000067336
Gene Namebone morphogenetic protein receptor, type II (serine/threonine kinase)
Synonyms2610024H22Rik, BMPRII, BMPR-II, BMP-2
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59763400-59879014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59868126 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 793 (T793A)
Ref Sequence ENSEMBL: ENSMUSP00000084701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087435]
Predicted Effect probably benign
Transcript: ENSMUST00000087435
AA Change: T793A

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084701
Gene: ENSMUSG00000067336
AA Change: T793A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 33 131 6.9e-17 PFAM
low complexity region 132 142 N/A INTRINSIC
transmembrane domain 152 174 N/A INTRINSIC
Pfam:Pkinase 203 501 6.6e-33 PFAM
Pfam:Pkinase_Tyr 203 501 1.3e-29 PFAM
low complexity region 545 558 N/A INTRINSIC
low complexity region 603 628 N/A INTRINSIC
low complexity region 694 710 N/A INTRINSIC
low complexity region 901 908 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type II receptor that binds extracellular BMPs and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important during embryonic development. Mutations in this gene can cause pulmonary hypertension. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous null mutants arrest at the egg cylinder stage and die before embryonic day 9.5 with failure to form organized structure and lacking mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Bmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Bmpr2 APN 1 59815315 missense possibly damaging 0.88
IGL01366:Bmpr2 APN 1 59813677 missense probably damaging 1.00
IGL02281:Bmpr2 APN 1 59868344 missense probably damaging 1.00
IGL02531:Bmpr2 APN 1 59845714 splice site probably null
IGL03114:Bmpr2 APN 1 59867444 missense probably damaging 1.00
R0114:Bmpr2 UTSW 1 59815340 missense probably damaging 1.00
R0145:Bmpr2 UTSW 1 59867580 frame shift probably null
R0423:Bmpr2 UTSW 1 59868510 missense probably benign
R0480:Bmpr2 UTSW 1 59845659 missense probably damaging 1.00
R0556:Bmpr2 UTSW 1 59815328 missense probably damaging 1.00
R0597:Bmpr2 UTSW 1 59841425 splice site probably benign
R1167:Bmpr2 UTSW 1 59859304 missense probably damaging 1.00
R1769:Bmpr2 UTSW 1 59868361 missense probably damaging 1.00
R1946:Bmpr2 UTSW 1 59868397 missense possibly damaging 0.83
R1972:Bmpr2 UTSW 1 59813603 missense possibly damaging 0.55
R4524:Bmpr2 UTSW 1 59867412 missense probably benign 0.00
R4558:Bmpr2 UTSW 1 59845692 missense probably damaging 0.99
R4667:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4668:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4669:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4868:Bmpr2 UTSW 1 59870456 missense probably benign 0.03
R4922:Bmpr2 UTSW 1 59867424 missense probably benign
R5015:Bmpr2 UTSW 1 59851224 missense probably damaging 1.00
R5421:Bmpr2 UTSW 1 59870418 missense possibly damaging 0.96
R5808:Bmpr2 UTSW 1 59867401 missense probably benign 0.09
R6057:Bmpr2 UTSW 1 59842818 missense probably benign 0.00
R6228:Bmpr2 UTSW 1 59867436 missense probably benign 0.11
R6449:Bmpr2 UTSW 1 59867437 missense probably damaging 0.99
R6475:Bmpr2 UTSW 1 59868344 missense probably damaging 1.00
R6754:Bmpr2 UTSW 1 59870280 missense probably damaging 1.00
R7080:Bmpr2 UTSW 1 59867683 missense probably benign 0.00
R7410:Bmpr2 UTSW 1 59868493 missense probably benign
R7425:Bmpr2 UTSW 1 59867351 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGGACAACAGGACTTCACACAGGC -3'
(R):5'- GATCCAGAACCCCTTCATCATGGC -3'

Sequencing Primer
(F):5'- TTCACACAGGCTGCAAATGG -3'
(R):5'- CATGCTCATCAGGACTGGAATTG -3'
Posted On2014-04-13