Incidental Mutation 'R1537:Ddb2'
ID169573
Institutional Source Beutler Lab
Gene Symbol Ddb2
Ensembl Gene ENSMUSG00000002109
Gene Namedamage specific DNA binding protein 2
Synonyms2610043A19Rik, p48
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91211572-91236982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91234889 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 64 (S64P)
Ref Sequence ENSEMBL: ENSMUSP00000028696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028696] [ENSMUST00000111352]
Predicted Effect probably benign
Transcript: ENSMUST00000028696
AA Change: S64P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028696
Gene: ENSMUSG00000002109
AA Change: S64P

DomainStartEndE-ValueType
low complexity region 48 69 N/A INTRINSIC
WD40 100 140 1.48e-2 SMART
WD40 144 185 7.92e1 SMART
WD40 187 229 7.36e1 SMART
WD40 231 271 3.14e-6 SMART
WD40 278 316 3.55e-5 SMART
Blast:WD40 379 419 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111352
SMART Domains Protein: ENSMUSP00000106984
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
WD40 8 49 7.92e1 SMART
WD40 51 93 7.36e1 SMART
WD40 95 135 3.14e-6 SMART
WD40 142 180 3.55e-5 SMART
Blast:WD40 243 283 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181191
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for the repair of ultraviolet light-damaged DNA. This protein is the smaller subunit of a heterodimeric protein complex that participates in nucleotide excision repair, and this complex mediates the ubiquitylation of histones H3 and H4, which facilitates the cellular response to DNA damage. This subunit appears to be required for DNA binding. Mutations in this gene cause xeroderma pigmentosum complementation group E, a recessive disease that is characterized by an increased sensitivity to UV light and a high predisposition for skin cancer development, in some cases accompanied by neurological abnormalities. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutant mice are prone to both spontaneous and UV-induced skin cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Med1 A G 11: 98,160,946 V497A probably damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Ddb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0054:Ddb2 UTSW 2 91234820 missense probably benign 0.14
R0054:Ddb2 UTSW 2 91234820 missense probably benign 0.14
R1679:Ddb2 UTSW 2 91234250 missense probably benign 0.00
R1707:Ddb2 UTSW 2 91234209 missense probably damaging 1.00
R2858:Ddb2 UTSW 2 91216677 missense probably damaging 1.00
R4797:Ddb2 UTSW 2 91236818 utr 5 prime probably benign
R4985:Ddb2 UTSW 2 91212298 unclassified probably null
R5256:Ddb2 UTSW 2 91236728 missense probably damaging 0.98
R5666:Ddb2 UTSW 2 91212581 missense probably damaging 1.00
R5670:Ddb2 UTSW 2 91212581 missense probably damaging 1.00
R5768:Ddb2 UTSW 2 91211992 missense possibly damaging 0.67
R7324:Ddb2 UTSW 2 91236884 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACTGGCCTTGTGCATCAACTATCTG -3'
(R):5'- CTGGCAAAGCTCTAAGGAACCCTG -3'

Sequencing Primer
(F):5'- CAATCATCATACCTGGGGGTGAC -3'
(R):5'- GCTCTAAGGAACCCTGTGAGG -3'
Posted On2014-04-13