Incidental Mutation 'R1537:Med1'
Institutional Source Beutler Lab
Gene Symbol Med1
Ensembl Gene ENSMUSG00000018160
Gene Namemediator complex subunit 1
SynonymsPparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220
MMRRC Submission 039576-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1537 (G1)
Quality Score225
Status Not validated
Chromosomal Location98152154-98193293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98160946 bp
Amino Acid Change Valine to Alanine at position 497 (V497A)
Ref Sequence ENSEMBL: ENSMUSP00000090411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000107545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018304
AA Change: V482A

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160
AA Change: V482A

Pfam:Med1 18 414 3.7e-112 PFAM
low complexity region 536 559 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 667 678 N/A INTRINSIC
low complexity region 960 981 N/A INTRINSIC
low complexity region 989 999 N/A INTRINSIC
low complexity region 1015 1036 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1063 1138 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1205 1243 N/A INTRINSIC
low complexity region 1250 1281 N/A INTRINSIC
low complexity region 1344 1364 N/A INTRINSIC
low complexity region 1482 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092735
AA Change: V497A

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160
AA Change: V497A

Pfam:Med1 33 429 1.2e-113 PFAM
transmembrane domain 585 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107545
AA Change: V497A

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160
AA Change: V497A

Pfam:Med1 59 426 2.9e-74 PFAM
low complexity region 551 574 N/A INTRINSIC
low complexity region 610 634 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 975 996 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
low complexity region 1030 1051 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1078 1153 N/A INTRINSIC
low complexity region 1185 1198 N/A INTRINSIC
low complexity region 1220 1258 N/A INTRINSIC
low complexity region 1265 1296 N/A INTRINSIC
low complexity region 1359 1379 N/A INTRINSIC
low complexity region 1497 1518 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147933
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,475 H86L possibly damaging Het
2610507B11Rik T A 11: 78,289,343 Y2150N probably damaging Het
4930519G04Rik A G 5: 114,870,217 T31A probably benign Het
Ahcyl1 A G 3: 107,696,189 F30S probably benign Het
Alox5ap G A 5: 149,265,183 probably null Het
Amtn A G 5: 88,378,870 S53G probably null Het
Arap3 A T 18: 37,989,684 probably null Het
Ash1l T A 3: 89,072,476 V2769E probably damaging Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bhlha9 C T 11: 76,672,631 S28L probably benign Het
Bmpr2 A G 1: 59,868,126 T793A probably benign Het
Ccdc80 G A 16: 45,095,936 A352T probably benign Het
Chst2 A T 9: 95,406,141 F51I probably benign Het
Col14a1 A G 15: 55,380,767 N412S unknown Het
Dclk2 T C 3: 86,806,184 I451V probably damaging Het
Ddb2 A G 2: 91,234,889 S64P probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dusp4 G T 8: 34,818,416 R277L probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Garem1 A T 18: 21,168,874 probably null Het
Gnpat A G 8: 124,870,816 E39G probably damaging Het
Golgb1 A T 16: 36,898,788 Q352L possibly damaging Het
Hdlbp T C 1: 93,417,374 D803G probably benign Het
Hps1 A G 19: 42,759,704 probably null Het
Ilvbl G A 10: 78,579,731 R327H probably benign Het
Itpr3 A G 17: 27,114,147 D1911G possibly damaging Het
Lmo7 T A 14: 101,929,264 probably benign Het
Mcm10 G A 2: 4,998,780 T542I possibly damaging Het
Mn1 G A 5: 111,454,780 A1295T probably damaging Het
Myh7b A C 2: 155,631,787 D1580A probably damaging Het
Naa20 A G 2: 145,912,518 I101V probably benign Het
Nav3 T C 10: 109,866,985 Y229C probably damaging Het
Obscn T C 11: 59,000,749 R6986G unknown Het
Olfr573-ps1 G A 7: 102,942,340 T79I probably damaging Het
Olfr878 A G 9: 37,919,274 I211V probably benign Het
P2rx3 A G 2: 85,023,481 probably null Het
Papd4 C T 13: 93,175,568 G208D probably damaging Het
Pcdhac2 G A 18: 37,146,486 G840R possibly damaging Het
Pclo A G 5: 14,712,475 N3654S unknown Het
Pcnx2 T A 8: 125,877,449 E689D possibly damaging Het
Pds5a A G 5: 65,647,121 S532P probably benign Het
Phf1 G A 17: 26,935,398 probably null Het
Pkp4 G A 2: 59,214,803 V41M probably damaging Het
Prlr T G 15: 10,328,278 probably null Het
Prr12 G T 7: 45,028,942 A1954D unknown Het
Prtg A G 9: 72,809,757 T127A probably benign Het
Ptprh A G 7: 4,549,699 L884P probably damaging Het
Rnf170 T A 8: 26,139,048 D183E probably benign Het
Rrp12 A T 19: 41,886,803 H339Q probably damaging Het
Rubcnl T G 14: 75,040,827 S350R possibly damaging Het
Sgo2b T A 8: 63,926,502 T1099S possibly damaging Het
Ska2 T C 11: 87,116,119 S17P probably damaging Het
Slc38a2 A G 15: 96,693,153 I243T possibly damaging Het
Sptan1 T A 2: 30,026,022 D2007E possibly damaging Het
Taar5 T A 10: 23,970,722 L6H probably benign Het
Tbata G T 10: 61,183,491 probably null Het
Tmem107 T C 11: 69,072,458 S98P probably damaging Het
Tpst2 A G 5: 112,308,420 D275G possibly damaging Het
Ttc28 G T 5: 111,285,318 G2073W probably damaging Het
Ttc7 T C 17: 87,322,463 V291A possibly damaging Het
Vps13b T A 15: 35,792,181 N2198K possibly damaging Het
Wdr37 A T 13: 8,837,003 D249E probably benign Het
Wdr63 T C 3: 146,042,749 E870G probably damaging Het
Xirp2 G T 2: 67,510,013 C866F probably damaging Het
Zfp990 A G 4: 145,536,996 E188G possibly damaging Het
Zkscan2 A G 7: 123,499,841 S43P possibly damaging Het
Zscan5b A G 7: 6,233,851 R200G probably benign Het
Other mutations in Med1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Med1 APN 11 98155684 intron probably benign
IGL00690:Med1 APN 11 98169400 missense possibly damaging 0.94
IGL01087:Med1 APN 11 98180285 missense probably damaging 1.00
IGL01133:Med1 APN 11 98157986 nonsense probably null
IGL02223:Med1 APN 11 98157876 missense probably damaging 1.00
IGL02257:Med1 APN 11 98180270 missense probably damaging 0.98
IGL02699:Med1 APN 11 98180025 missense possibly damaging 0.61
IGL02706:Med1 APN 11 98156707 intron probably benign
IGL02902:Med1 APN 11 98156509 intron probably benign
IGL02986:Med1 APN 11 98156260 intron probably benign
IGL03011:Med1 APN 11 98161033 missense possibly damaging 0.92
IGL03282:Med1 APN 11 98156817 missense probably damaging 1.00
IGL03303:Med1 APN 11 98158352 missense probably damaging 1.00
IGL03342:Med1 APN 11 98189180 critical splice donor site probably null
IGL03410:Med1 APN 11 98189183 missense possibly damaging 0.62
PIT4453001:Med1 UTSW 11 98158417 missense probably benign 0.40
R0040:Med1 UTSW 11 98166255 critical splice donor site probably null
R0206:Med1 UTSW 11 98155689 intron probably benign
R0206:Med1 UTSW 11 98155689 intron probably benign
R0208:Med1 UTSW 11 98155689 intron probably benign
R0310:Med1 UTSW 11 98167574 missense probably benign 0.38
R0505:Med1 UTSW 11 98156904 missense probably damaging 1.00
R0597:Med1 UTSW 11 98169438 missense probably benign 0.08
R0680:Med1 UTSW 11 98180166 splice site probably null
R0686:Med1 UTSW 11 98158404 missense probably damaging 1.00
R0698:Med1 UTSW 11 98155689 intron probably benign
R1293:Med1 UTSW 11 98157036 missense possibly damaging 0.93
R1302:Med1 UTSW 11 98157449 missense possibly damaging 0.50
R1365:Med1 UTSW 11 98155995 intron probably benign
R1609:Med1 UTSW 11 98161170 missense possibly damaging 0.91
R1631:Med1 UTSW 11 98155626 intron probably benign
R1792:Med1 UTSW 11 98157283 missense probably damaging 1.00
R1831:Med1 UTSW 11 98156611 intron probably benign
R1837:Med1 UTSW 11 98169412 missense probably damaging 1.00
R2366:Med1 UTSW 11 98161182 missense probably damaging 0.98
R3754:Med1 UTSW 11 98166722 missense possibly damaging 0.77
R3762:Med1 UTSW 11 98155515 intron probably benign
R4012:Med1 UTSW 11 98171706 missense possibly damaging 0.85
R4112:Med1 UTSW 11 98180087 missense probably damaging 1.00
R4384:Med1 UTSW 11 98152862 unclassified probably benign
R4579:Med1 UTSW 11 98158422 missense possibly damaging 0.56
R4740:Med1 UTSW 11 98180264 nonsense probably null
R4819:Med1 UTSW 11 98155432 intron probably benign
R4879:Med1 UTSW 11 98155360 unclassified probably benign
R4993:Med1 UTSW 11 98163904 missense probably damaging 1.00
R5040:Med1 UTSW 11 98155404 intron probably benign
R5249:Med1 UTSW 11 98157240 missense probably benign 0.43
R5373:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5374:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5552:Med1 UTSW 11 98166331 nonsense probably null
R5692:Med1 UTSW 11 98156380 intron probably benign
R6010:Med1 UTSW 11 98158362 missense probably damaging 1.00
R6149:Med1 UTSW 11 98183853 missense possibly damaging 0.74
R6417:Med1 UTSW 11 98157228 missense probably damaging 0.97
R7301:Med1 UTSW 11 98152808 missense probably benign 0.23
R7507:Med1 UTSW 11 98158026 missense probably damaging 1.00
R7529:Med1 UTSW 11 98155965 missense unknown
R7588:Med1 UTSW 11 98155572 missense unknown
R7654:Med1 UTSW 11 98169363 missense possibly damaging 0.75
R7662:Med1 UTSW 11 98155392 missense unknown
R7679:Med1 UTSW 11 98156061 missense unknown
R7862:Med1 UTSW 11 98161210 missense probably benign 0.05
R8447:Med1 UTSW 11 98169414 missense probably damaging 1.00
R8693:Med1 UTSW 11 98155773 missense unknown
R8843:Med1 UTSW 11 98189276 missense possibly damaging 0.88
Z1176:Med1 UTSW 11 98161183 missense possibly damaging 0.62
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acacacatttaaacccagcac -3'
Posted On2014-04-13