Mutagenetix > Incidental Mutation

Incidental Mutation 'R1538:Cacna1e'

169647

Institutional Source

Beutler Lab

Gene Symbol

Cacna1e

Ensembl Gene

ENSMUSG00000004110

Gene Name

calcium channel, voltage-dependent, R type, alpha 1E subunit

Synonyms

Cchra1, alpha1E, Cav2.3

MMRRC Submission

039577-MU

Accession Numbers

Genbank: NM_009782; MGI: 106217

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R1538 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

154390731-154884501 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 154561758 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 344 (L344P)

Ref Sequence

ENSEMBL: ENSMUSP00000140937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004214] [ENSMUST00000187541] [ENSMUST00000211821]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004214
AA Change: L36P

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000004214
Gene: ENSMUSG00000004110
AA Change: L36P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	1	55	6.7e-10	PFAM
Pfam:Ion_trans	168	407	3.3e-56	PFAM
Pfam:PKD_channel	257	401	3.3e-7	PFAM
low complexity region	409	414	N/A	INTRINSIC
low complexity region	455	469	N/A	INTRINSIC
low complexity region	496	514	N/A	INTRINSIC
low complexity region	604	620	N/A	INTRINSIC
low complexity region	626	640	N/A	INTRINSIC
coiled coil region	793	823	N/A	INTRINSIC
Pfam:Ion_trans	847	1128	2.3e-63	PFAM
Pfam:Ion_trans	1172	1429	2.6e-65	PFAM
Pfam:PKD_channel	1256	1424	2.8e-10	PFAM
Pfam:GPHH	1431	1500	1.3e-37	PFAM
Ca_chan_IQ	1555	1589	5.93e-13	SMART
low complexity region	1701	1717	N/A	INTRINSIC
low complexity region	1729	1742	N/A	INTRINSIC
low complexity region	1764	1780	N/A	INTRINSIC
low complexity region	1789	1804	N/A	INTRINSIC
low complexity region	1808	1822	N/A	INTRINSIC
low complexity region	1832	1846	N/A	INTRINSIC
low complexity region	1867	1878	N/A	INTRINSIC
low complexity region	1936	1946	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000187541
AA Change: L344P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140937
Gene: ENSMUSG00000004110
AA Change: L344P

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	351	8.5e-54	PFAM
PDB:4DEX\|B	354	462	6e-36	PDB
Pfam:Ion_trans	511	703	2.2e-46	PFAM
Pfam:PKD_channel	565	710	1.4e-6	PFAM
low complexity region	717	722	N/A	INTRINSIC
low complexity region	763	777	N/A	INTRINSIC
low complexity region	804	822	N/A	INTRINSIC
low complexity region	912	928	N/A	INTRINSIC
low complexity region	934	948	N/A	INTRINSIC
coiled coil region	1101	1131	N/A	INTRINSIC
low complexity region	1162	1175	N/A	INTRINSIC
Pfam:Ion_trans	1191	1425	4.3e-55	PFAM
Pfam:Ion_trans	1515	1725	5.3e-60	PFAM
Pfam:PKD_channel	1565	1732	4.7e-10	PFAM
Ca_chan_IQ	1863	1897	5.93e-13	SMART
low complexity region	2009	2025	N/A	INTRINSIC
low complexity region	2037	2050	N/A	INTRINSIC
low complexity region	2072	2088	N/A	INTRINSIC
low complexity region	2097	2112	N/A	INTRINSIC
low complexity region	2116	2130	N/A	INTRINSIC
low complexity region	2140	2154	N/A	INTRINSIC
low complexity region	2175	2186	N/A	INTRINSIC
low complexity region	2244	2254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188965

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211821
AA Change: L282P

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Voltage-sensitive calcium channels mediate the entry of calcium ions into excitable cells and are also involved in a variety of calcium-dependent processes. Voltage-dependent calcium channels are multi-subunit complexes, comprised of alpha-1, alpha-2, beta and delta subunits in a 1:1:1:1 ratio. The isoform alpha-1E gives rise to R-type calcium currents and belongs to the high-voltage activated group. Calcium channels containing the alpha-1E subunit may be involved in the modulation of neuronal firing patterns, an important component of information processing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered R-type Ca2+ channels, increased timidity and body weight, impaired glucose tolerance, reduced locomotor activity, and lack of the cocaine stimulation of locomotor response. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, knock-out(3) Targeted, other(3) Gene trapped(1)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,065,401	R117L	probably benign	Het
4930447C04Rik	G	A	12: 72,881,346	A537V	possibly damaging	Het
4930579F01Rik	A	C	3: 138,183,756	D33E	probably damaging	Het
9530053A07Rik	A	T	7: 28,155,492	I1848F	probably damaging	Het
Acnat1	T	C	4: 49,447,835	K249E	possibly damaging	Het
Ankrd13a	T	C	5: 114,804,234	I526T	possibly damaging	Het
Aplp1	C	A	7: 30,436,027	E535D	probably benign	Het
Armc8	T	A	9: 99,505,290	H425L	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asprv1	C	T	6: 86,628,636	Q155*	probably null	Het
Atl1	A	G	12: 69,926,188	Q94R	probably benign	Het
Atp2a2	A	G	5: 122,457,377	L970P	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Bod1l	A	G	5: 41,816,429	M2514T	probably benign	Het
Cacfd1	T	A	2: 27,018,939	D97E	probably benign	Het
Cacna2d2	C	A	9: 107,517,416	R596S	probably damaging	Het
Catip	C	A	1: 74,364,652	S176*	probably null	Het
Cdcp1	G	A	9: 123,173,588	S806L	probably damaging	Het
Cdk6	A	T	5: 3,520,675	I289L	probably benign	Het
Cers3	C	T	7: 66,781,823	T182I	probably damaging	Het
Cfap46	T	A	7: 139,683,008	N43I	probably null	Het
Clec4n	A	T	6: 123,230,033	R5S	possibly damaging	Het
Cnr2	G	T	4: 135,916,701	S30I	probably benign	Het
Col18a1	C	T	10: 77,071,336	G870E	probably damaging	Het
Cpne6	T	C	14: 55,515,220	V289A	possibly damaging	Het
Crym	G	A	7: 120,197,715	L141F	probably benign	Het
Cxxc5	T	C	18: 35,858,569	S8P	unknown	Het
Dido1	A	C	2: 180,684,970	S453R	possibly damaging	Het
Dnah2	A	C	11: 69,477,202	S1770R	probably benign	Het
Dnah7a	A	G	1: 53,495,989	V2704A	possibly damaging	Het
Eml5	T	C	12: 98,794,276	N1738S	probably damaging	Het
Eri3	A	G	4: 117,582,639	T138A	possibly damaging	Het
Ext2	C	T	2: 93,707,287	E585K	probably damaging	Het
Fam35a	C	G	14: 34,268,876	Q24H	probably damaging	Het
Fam84b	A	G	15: 60,823,649	C83R	probably damaging	Het
Fbxw19	T	A	9: 109,494,988	S38C	probably damaging	Het
Fmo6	G	A	1: 162,926,106	P156S	probably damaging	Het
Frem3	T	C	8: 80,612,710	L544P	probably damaging	Het
Frem3	A	T	8: 80,613,135	I686F	probably benign	Het
Gabra1	T	C	11: 42,140,350	Y251C	probably benign	Het
Gemin4	G	T	11: 76,211,161	Q925K	probably benign	Het
Gm18856	T	A	13: 13,964,689		probably benign	Het
Gnb1	A	T	4: 155,551,714	T164S	probably benign	Het
Gpx6	A	G	13: 21,313,652	D31G	possibly damaging	Het
Gzmd	A	C	14: 56,130,345	I157S	probably benign	Het
Il31ra	T	A	13: 112,547,466	N43I	possibly damaging	Het
Irak3	T	C	10: 120,165,130	T297A	probably benign	Het
Kank2	T	C	9: 21,774,631	D649G	probably damaging	Het
Kif3b	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	2: 153,317,462		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	G	9: 110,446,747	F111S	probably damaging	Het
Lrp5	A	G	19: 3,647,585	S319P	possibly damaging	Het
Marc1	T	C	1: 184,802,002	E223G	probably damaging	Het
Mettl15	T	C	2: 109,131,665		probably null	Het
Ncoa1	T	C	12: 4,270,748	Q1107R	possibly damaging	Het
Ncoa7	T	G	10: 30,694,211	M251L	probably damaging	Het
Nos2	A	T	11: 78,956,570	M1023L	probably benign	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Olfr1491	A	T	19: 13,705,496	Y223F	probably damaging	Het
Olfr177	T	A	16: 58,872,898	N84I	probably damaging	Het
Olfr482	T	A	7: 108,095,286	I95F	probably damaging	Het
Olfr591	A	G	7: 103,172,986	I217T	probably damaging	Het
Olfr711	A	T	7: 106,971,983	Y120*	probably null	Het
Olfr776	T	C	10: 129,261,213	I84T	probably damaging	Het
Parm1	G	A	5: 91,594,447	E225K	possibly damaging	Het
Pdzd2	A	C	15: 12,372,961	S2363A	probably damaging	Het
Piezo1	A	G	8: 122,491,403	L1199P	probably damaging	Het
Prpsap1	A	T	11: 116,479,708	M141K	probably benign	Het
Prss29	A	T	17: 25,320,283	M1L	possibly damaging	Het
Pter	T	A	2: 12,978,606	S141T	probably benign	Het
Ptpru	A	T	4: 131,774,351	D1181E	probably damaging	Het
Rab3ip	T	A	10: 116,939,254	Q66H	probably damaging	Het
Rgs12	A	T	5: 35,021,167	T779S	probably damaging	Het
Rgs22	A	G	15: 36,048,776	F786S	probably damaging	Het
Rnasel	A	T	1: 153,760,794	D640V	possibly damaging	Het
Rp1	T	C	1: 4,345,676	T1738A	probably damaging	Het
Sacs	T	C	14: 61,210,059	S3185P	probably damaging	Het
Scnn1a	T	A	6: 125,338,893	D321E	possibly damaging	Het
Sec31b	G	C	19: 44,518,586	L1014V	probably benign	Het
Serpinb10	A	G	1: 107,540,960	Y111C	probably damaging	Het
Siglecg	A	G	7: 43,417,889	K627E	possibly damaging	Het
Sigmar1	T	C	4: 41,740,845	I95V	probably benign	Het
Sirpb1b	T	A	3: 15,548,759	T88S	possibly damaging	Het
Spire2	T	G	8: 123,358,156	L245R	probably damaging	Het
Stard9	C	A	2: 120,696,711	P1150T	probably benign	Het
Stat6	C	A	10: 127,653,256	T380N	probably damaging	Het
Sult3a1	G	A	10: 33,870,170	G162E	probably benign	Het
Surf4	T	C	2: 26,933,698		probably null	Het
Tacc2	T	C	7: 130,625,419	M1278T	probably benign	Het
Tacr2	T	A	10: 62,261,327		probably null	Het
Tcaf1	A	T	6: 42,678,989	V351E	probably damaging	Het
Tmcc2	A	G	1: 132,380,980	S59P	probably damaging	Het
Tmem17	G	A	11: 22,517,266	S60N	possibly damaging	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tmprss7	A	T	16: 45,679,390	I307N	probably benign	Het
Treml2	A	T	17: 48,302,758	T73S	possibly damaging	Het
Trrap	A	G	5: 144,837,202	H2876R	possibly damaging	Het
Tyw3	A	G	3: 154,596,869	I53T	probably damaging	Het
Ugp2	A	G	11: 21,333,791	I92T	possibly damaging	Het
Vmn2r66	A	T	7: 84,994,958	M748K	possibly damaging	Het
Vmn2r82	T	C	10: 79,356,744	S52P	possibly damaging	Het
Wdr37	A	T	13: 8,836,792	S320T	probably benign	Het
Zbtb16	A	T	9: 48,832,283	M243K	probably benign	Het
Zfr	C	T	15: 12,150,243	T432I	possibly damaging	Het

Other mutations in Cacna1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Cacna1e	APN	1	154403683	missense	probably damaging	0.99
IGL01086:Cacna1e	APN	1	154471601	missense	probably benign	0.04
IGL01302:Cacna1e	APN	1	154443907	missense	probably damaging	1.00
IGL01386:Cacna1e	APN	1	154472377	missense	probably benign	0.18
IGL01573:Cacna1e	APN	1	154471367	missense	probably benign
IGL01676:Cacna1e	APN	1	154398476	missense	probably damaging	1.00
IGL01676:Cacna1e	APN	1	154412450	missense	probably damaging	1.00
IGL01762:Cacna1e	APN	1	154471373	missense	possibly damaging	0.78
IGL01801:Cacna1e	APN	1	154471340	missense	probably null	0.00
IGL01895:Cacna1e	APN	1	154443900	missense	probably damaging	1.00
IGL02391:Cacna1e	APN	1	154421113	missense	probably damaging	1.00
IGL02399:Cacna1e	APN	1	154403747	missense	probably damaging	1.00
IGL02659:Cacna1e	APN	1	154426528	missense	probably damaging	1.00
IGL02686:Cacna1e	APN	1	154493409	missense	probably damaging	1.00
IGL02838:Cacna1e	APN	1	154445648	missense	probably damaging	1.00
IGL02958:Cacna1e	APN	1	154465741	missense	probably damaging	1.00
IGL02981:Cacna1e	APN	1	154471425	missense	probably benign	0.15
IGL03120:Cacna1e	APN	1	154443881	missense	probably damaging	1.00
IGL03232:Cacna1e	APN	1	154493358	missense	probably damaging	1.00
IGL03310:Cacna1e	APN	1	154442251	missense	probably damaging	1.00
IGL03342:Cacna1e	APN	1	154466944	critical splice donor site	probably null
bezoar	UTSW	1	154436554	splice site	probably null
hairball	UTSW	1	154479305	missense	probably damaging	0.97
N/A - 535:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R0122:Cacna1e	UTSW	1	154443901	missense	probably damaging	1.00
R0143:Cacna1e	UTSW	1	154448947	splice site	probably null
R0314:Cacna1e	UTSW	1	154442251	missense	probably damaging	1.00
R0366:Cacna1e	UTSW	1	154416138	missense	probably benign	0.03
R0626:Cacna1e	UTSW	1	154488817	missense	probably damaging	0.99
R0739:Cacna1e	UTSW	1	154442278	missense	probably damaging	0.97
R1272:Cacna1e	UTSW	1	154444968	missense	probably damaging	1.00
R1300:Cacna1e	UTSW	1	154398673	missense	probably benign
R1340:Cacna1e	UTSW	1	154472657	missense	probably damaging	1.00
R1440:Cacna1e	UTSW	1	154561806	missense	possibly damaging	0.63
R1449:Cacna1e	UTSW	1	154485662	critical splice donor site	probably null
R1542:Cacna1e	UTSW	1	154477779	missense	probably benign	0.01
R1560:Cacna1e	UTSW	1	154421104	nonsense	probably null
R1748:Cacna1e	UTSW	1	154486569	missense	possibly damaging	0.92
R1749:Cacna1e	UTSW	1	154444000	missense	probably damaging	1.00
R1912:Cacna1e	UTSW	1	154436449	missense	probably damaging	1.00
R1968:Cacna1e	UTSW	1	154700494	missense	probably damaging	1.00
R1993:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R1994:Cacna1e	UTSW	1	154477817	missense	probably damaging	0.97
R2191:Cacna1e	UTSW	1	154443845	missense	probably damaging	1.00
R2291:Cacna1e	UTSW	1	154403683	missense	probably damaging	0.99
R2417:Cacna1e	UTSW	1	154472193	missense	probably damaging	1.00
R3608:Cacna1e	UTSW	1	154416085	missense	probably benign	0.08
R3757:Cacna1e	UTSW	1	154633696	missense	probably damaging	0.97
R3890:Cacna1e	UTSW	1	154483553	missense	probably damaging	1.00
R4015:Cacna1e	UTSW	1	154482585	missense	probably damaging	1.00
R4088:Cacna1e	UTSW	1	154412183	splice site	probably null
R4275:Cacna1e	UTSW	1	154493325	missense	probably damaging	1.00
R4282:Cacna1e	UTSW	1	154426550	missense	probably benign	0.04
R4297:Cacna1e	UTSW	1	154398731	missense	probably benign	0.37
R4356:Cacna1e	UTSW	1	154443981	missense	probably damaging	1.00
R4510:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4511:Cacna1e	UTSW	1	154561833	missense	probably damaging	1.00
R4577:Cacna1e	UTSW	1	154402027	missense	possibly damaging	0.92
R4590:Cacna1e	UTSW	1	154436519	missense	possibly damaging	0.87
R4601:Cacna1e	UTSW	1	154471613	missense	probably benign
R4622:Cacna1e	UTSW	1	154471565	missense	possibly damaging	0.81
R4626:Cacna1e	UTSW	1	154482548	splice site	probably null
R4694:Cacna1e	UTSW	1	154437266	critical splice donor site	probably null
R4727:Cacna1e	UTSW	1	154436468	nonsense	probably null
R4839:Cacna1e	UTSW	1	154421058	missense	probably damaging	1.00
R4851:Cacna1e	UTSW	1	154436554	splice site	probably null
R4894:Cacna1e	UTSW	1	154488805	nonsense	probably null
R4934:Cacna1e	UTSW	1	154481634	nonsense	probably null
R4979:Cacna1e	UTSW	1	154413993	missense	probably damaging	1.00
R5077:Cacna1e	UTSW	1	154561729	critical splice donor site	probably null
R5128:Cacna1e	UTSW	1	154402021	missense	probably damaging	0.98
R5214:Cacna1e	UTSW	1	154701364	missense	possibly damaging	0.93
R5274:Cacna1e	UTSW	1	154700504	missense	probably damaging	0.98
R5388:Cacna1e	UTSW	1	154477796	missense	probably damaging	1.00
R5416:Cacna1e	UTSW	1	154465779	missense	probably damaging	1.00
R5469:Cacna1e	UTSW	1	154443937	missense	probably damaging	1.00
R5475:Cacna1e	UTSW	1	154725709	missense	possibly damaging	0.53
R5607:Cacna1e	UTSW	1	154471340	missense	probably benign	0.00
R5615:Cacna1e	UTSW	1	154412170	missense	probably damaging	1.00
R5616:Cacna1e	UTSW	1	154442194	missense	probably damaging	1.00
R5627:Cacna1e	UTSW	1	154635858	missense	probably damaging	0.98
R5707:Cacna1e	UTSW	1	154633717	missense	probably damaging	1.00
R5756:Cacna1e	UTSW	1	154471637	missense	probably benign	0.00
R5893:Cacna1e	UTSW	1	154437323	missense	probably damaging	1.00
R6117:Cacna1e	UTSW	1	154561791	missense	possibly damaging	0.68
R6134:Cacna1e	UTSW	1	154701291	missense	probably damaging	1.00
R6190:Cacna1e	UTSW	1	154486570	missense	possibly damaging	0.47
R6279:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6295:Cacna1e	UTSW	1	154442173	missense	probably damaging	0.98
R6300:Cacna1e	UTSW	1	154425932	missense	probably benign	0.38
R6320:Cacna1e	UTSW	1	154441524	missense	possibly damaging	0.76
R6375:Cacna1e	UTSW	1	154479305	missense	probably damaging	0.97
R6830:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R6842:Cacna1e	UTSW	1	154483117	missense	probably damaging	1.00
R7023:Cacna1e	UTSW	1	154725693	missense	probably null	0.85
R7081:Cacna1e	UTSW	1	154700383	missense	possibly damaging	0.82
R7085:Cacna1e	UTSW	1	154473746	splice site	probably null
R7108:Cacna1e	UTSW	1	154468995	frame shift	probably null
R7142:Cacna1e	UTSW	1	154412484	missense	probably damaging	1.00
R7250:Cacna1e	UTSW	1	154700489	missense	possibly damaging	0.93
R7332:Cacna1e	UTSW	1	154725801	missense	possibly damaging	0.89
R7410:Cacna1e	UTSW	1	154472234	missense	probably benign	0.13
R7502:Cacna1e	UTSW	1	154468988	missense	probably null	0.35
R7556:Cacna1e	UTSW	1	154472673	missense	probably benign	0.28
R7563:Cacna1e	UTSW	1	154471416	missense	probably benign	0.00
R7573:Cacna1e	UTSW	1	154726165	intron	probably benign
R7689:Cacna1e	UTSW	1	154398803	missense	probably benign	0.01
R7699:Cacna1e	UTSW	1	154443928	missense	probably damaging	1.00
R7744:Cacna1e	UTSW	1	154465792	missense	probably damaging	1.00
R7754:Cacna1e	UTSW	1	154413117	missense	probably damaging	0.97
R7787:Cacna1e	UTSW	1	154482568	missense	probably damaging	0.98
R7818:Cacna1e	UTSW	1	154398406	missense	probably damaging	1.00
R7838:Cacna1e	UTSW	1	154471403	missense	probably benign	0.08
R7849:Cacna1e	UTSW	1	154633718	missense	probably damaging	1.00
R8011:Cacna1e	UTSW	1	154465822	missense	probably benign	0.01
R8094:Cacna1e	UTSW	1	154561770	missense	probably damaging	1.00
R8162:Cacna1e	UTSW	1	154701567	splice site	probably null
R8202:Cacna1e	UTSW	1	154398449	missense	probably benign
R8280:Cacna1e	UTSW	1	154469093	missense	probably damaging	0.97
R8354:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R8385:Cacna1e	UTSW	1	154443941	missense	probably damaging	0.98
R8532:Cacna1e	UTSW	1	154465764	missense	probably damaging	1.00
R8902:Cacna1e	UTSW	1	154473886	missense	probably benign	0.01
R8926:Cacna1e	UTSW	1	154701334	missense	possibly damaging	0.84
R8947:Cacna1e	UTSW	1	154402150	missense	probably benign	0.10
R9094:Cacna1e	UTSW	1	154479318	missense	possibly damaging	0.93
R9126:Cacna1e	UTSW	1	154467764	missense	probably benign	0.01
R9175:Cacna1e	UTSW	1	154398568	missense	probably damaging	1.00
R9286:Cacna1e	UTSW	1	154413099	missense	probably damaging	1.00
R9377:Cacna1e	UTSW	1	154485712	missense	possibly damaging	0.88
R9452:Cacna1e	UTSW	1	154413974	critical splice donor site	probably null
R9463:Cacna1e	UTSW	1	154481665	missense	probably damaging	1.00
R9513:Cacna1e	UTSW	1	154442287	missense	probably damaging	1.00
R9534:Cacna1e	UTSW	1	154444947	missense	possibly damaging	0.65
R9562:Cacna1e	UTSW	1	154407740	missense	probably benign	0.01
RF008:Cacna1e	UTSW	1	154442136	missense	probably damaging	1.00
X0062:Cacna1e	UTSW	1	154412492	missense	probably damaging	1.00
Z1176:Cacna1e	UTSW	1	154635850	missense	probably damaging	0.98
Z1177:Cacna1e	UTSW	1	154442292	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACATAGCTGGGATAACACTGGCAC -3'
(R):5'- TGATGTGGCCTTCACTAGGCACAG -3'

Sequencing Primer
(F):5'- TAACACTGGCACAAGGGTCTG -3'
(R):5'- GTTGAACTGTATCACGCCATGAC -3'

Posted On

2014-04-13