Incidental Mutation 'R1538:Ext2'
ID169655
Institutional Source Beutler Lab
Gene Symbol Ext2
Ensembl Gene ENSMUSG00000027198
Gene Nameexostoses (multiple) 2
Synonyms
MMRRC Submission 039577-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1538 (G1)
Quality Score204
Status Not validated
Chromosome2
Chromosomal Location93661028-93822568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93707287 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 585 (E585K)
Ref Sequence ENSEMBL: ENSMUSP00000028623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028623] [ENSMUST00000125407] [ENSMUST00000144780] [ENSMUST00000184931]
Predicted Effect probably damaging
Transcript: ENSMUST00000028623
AA Change: E585K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028623
Gene: ENSMUSG00000027198
AA Change: E585K

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 2.4e-59 PFAM
Pfam:Glyco_transf_64 456 701 1.1e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125407
SMART Domains Protein: ENSMUSP00000120291
Gene: ENSMUSG00000027198

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 8.8e-59 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132429
AA Change: E11K
SMART Domains Protein: ENSMUSP00000123492
Gene: ENSMUSG00000027198
AA Change: E11K

DomainStartEndE-ValueType
Pfam:Glyco_transf_64 1 100 5.7e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139321
Predicted Effect probably benign
Transcript: ENSMUST00000144780
Predicted Effect probably benign
Transcript: ENSMUST00000184931
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos lack heparan sulfate, initiate primitive streak formation but fail to form mesoderm, become growth arrested and die around gastrulation. Heterozygotes show various abnormalities in cartilage differentiation; about one-third form one or more exostoses on the ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,065,401 R117L probably benign Het
4930447C04Rik G A 12: 72,881,346 A537V possibly damaging Het
4930579F01Rik A C 3: 138,183,756 D33E probably damaging Het
9530053A07Rik A T 7: 28,155,492 I1848F probably damaging Het
Acnat1 T C 4: 49,447,835 K249E possibly damaging Het
Ankrd13a T C 5: 114,804,234 I526T possibly damaging Het
Aplp1 C A 7: 30,436,027 E535D probably benign Het
Armc8 T A 9: 99,505,290 H425L probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asprv1 C T 6: 86,628,636 Q155* probably null Het
Atl1 A G 12: 69,926,188 Q94R probably benign Het
Atp2a2 A G 5: 122,457,377 L970P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bod1l A G 5: 41,816,429 M2514T probably benign Het
Cacfd1 T A 2: 27,018,939 D97E probably benign Het
Cacna1e A G 1: 154,561,758 L344P probably damaging Het
Cacna2d2 C A 9: 107,517,416 R596S probably damaging Het
Catip C A 1: 74,364,652 S176* probably null Het
Cdcp1 G A 9: 123,173,588 S806L probably damaging Het
Cdk6 A T 5: 3,520,675 I289L probably benign Het
Cers3 C T 7: 66,781,823 T182I probably damaging Het
Cfap46 T A 7: 139,683,008 N43I probably null Het
Clec4n A T 6: 123,230,033 R5S possibly damaging Het
Cnr2 G T 4: 135,916,701 S30I probably benign Het
Col18a1 C T 10: 77,071,336 G870E probably damaging Het
Cpne6 T C 14: 55,515,220 V289A possibly damaging Het
Crym G A 7: 120,197,715 L141F probably benign Het
Cxxc5 T C 18: 35,858,569 S8P unknown Het
Dido1 A C 2: 180,684,970 S453R possibly damaging Het
Dnah2 A C 11: 69,477,202 S1770R probably benign Het
Dnah7a A G 1: 53,495,989 V2704A possibly damaging Het
Eml5 T C 12: 98,794,276 N1738S probably damaging Het
Eri3 A G 4: 117,582,639 T138A possibly damaging Het
Fam35a C G 14: 34,268,876 Q24H probably damaging Het
Fam84b A G 15: 60,823,649 C83R probably damaging Het
Fbxw19 T A 9: 109,494,988 S38C probably damaging Het
Fmo6 G A 1: 162,926,106 P156S probably damaging Het
Frem3 T C 8: 80,612,710 L544P probably damaging Het
Frem3 A T 8: 80,613,135 I686F probably benign Het
Gabra1 T C 11: 42,140,350 Y251C probably benign Het
Gemin4 G T 11: 76,211,161 Q925K probably benign Het
Gm18856 T A 13: 13,964,689 probably benign Het
Gnb1 A T 4: 155,551,714 T164S probably benign Het
Gpx6 A G 13: 21,313,652 D31G possibly damaging Het
Gzmd A C 14: 56,130,345 I157S probably benign Het
Il31ra T A 13: 112,547,466 N43I possibly damaging Het
Irak3 T C 10: 120,165,130 T297A probably benign Het
Kank2 T C 9: 21,774,631 D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,317,462 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,446,747 F111S probably damaging Het
Lrp5 A G 19: 3,647,585 S319P possibly damaging Het
Marc1 T C 1: 184,802,002 E223G probably damaging Het
Mettl15 T C 2: 109,131,665 probably null Het
Ncoa1 T C 12: 4,270,748 Q1107R possibly damaging Het
Ncoa7 T G 10: 30,694,211 M251L probably damaging Het
Nos2 A T 11: 78,956,570 M1023L probably benign Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Olfr1491 A T 19: 13,705,496 Y223F probably damaging Het
Olfr177 T A 16: 58,872,898 N84I probably damaging Het
Olfr482 T A 7: 108,095,286 I95F probably damaging Het
Olfr591 A G 7: 103,172,986 I217T probably damaging Het
Olfr711 A T 7: 106,971,983 Y120* probably null Het
Olfr776 T C 10: 129,261,213 I84T probably damaging Het
Parm1 G A 5: 91,594,447 E225K possibly damaging Het
Pdzd2 A C 15: 12,372,961 S2363A probably damaging Het
Piezo1 A G 8: 122,491,403 L1199P probably damaging Het
Prpsap1 A T 11: 116,479,708 M141K probably benign Het
Prss29 A T 17: 25,320,283 M1L possibly damaging Het
Pter T A 2: 12,978,606 S141T probably benign Het
Ptpru A T 4: 131,774,351 D1181E probably damaging Het
Rab3ip T A 10: 116,939,254 Q66H probably damaging Het
Rgs12 A T 5: 35,021,167 T779S probably damaging Het
Rgs22 A G 15: 36,048,776 F786S probably damaging Het
Rnasel A T 1: 153,760,794 D640V possibly damaging Het
Rp1 T C 1: 4,345,676 T1738A probably damaging Het
Sacs T C 14: 61,210,059 S3185P probably damaging Het
Scnn1a T A 6: 125,338,893 D321E possibly damaging Het
Sec31b G C 19: 44,518,586 L1014V probably benign Het
Serpinb10 A G 1: 107,540,960 Y111C probably damaging Het
Siglecg A G 7: 43,417,889 K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 I95V probably benign Het
Sirpb1b T A 3: 15,548,759 T88S possibly damaging Het
Spire2 T G 8: 123,358,156 L245R probably damaging Het
Stard9 C A 2: 120,696,711 P1150T probably benign Het
Stat6 C A 10: 127,653,256 T380N probably damaging Het
Sult3a1 G A 10: 33,870,170 G162E probably benign Het
Surf4 T C 2: 26,933,698 probably null Het
Tacc2 T C 7: 130,625,419 M1278T probably benign Het
Tacr2 T A 10: 62,261,327 probably null Het
Tcaf1 A T 6: 42,678,989 V351E probably damaging Het
Tmcc2 A G 1: 132,380,980 S59P probably damaging Het
Tmem17 G A 11: 22,517,266 S60N possibly damaging Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tmprss7 A T 16: 45,679,390 I307N probably benign Het
Treml2 A T 17: 48,302,758 T73S possibly damaging Het
Trrap A G 5: 144,837,202 H2876R possibly damaging Het
Tyw3 A G 3: 154,596,869 I53T probably damaging Het
Ugp2 A G 11: 21,333,791 I92T possibly damaging Het
Vmn2r66 A T 7: 84,994,958 M748K possibly damaging Het
Vmn2r82 T C 10: 79,356,744 S52P possibly damaging Het
Wdr37 A T 13: 8,836,792 S320T probably benign Het
Zbtb16 A T 9: 48,832,283 M243K probably benign Het
Zfr C T 15: 12,150,243 T432I possibly damaging Het
Other mutations in Ext2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Ext2 APN 2 93791073 missense probably benign
IGL01554:Ext2 APN 2 93811949 missense probably damaging 1.00
IGL01768:Ext2 APN 2 93791110 splice site probably benign
IGL02160:Ext2 APN 2 93813584 missense probably benign
IGL02677:Ext2 APN 2 93707245 missense probably damaging 1.00
IGL02939:Ext2 APN 2 93704619 splice site probably null
IGL03013:Ext2 APN 2 93707226 intron probably benign
IGL03286:Ext2 APN 2 93707272 missense probably damaging 1.00
R0018:Ext2 UTSW 2 93795692 missense probably damaging 1.00
R0526:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R0580:Ext2 UTSW 2 93795725 missense probably benign 0.31
R1383:Ext2 UTSW 2 93806113 missense possibly damaging 0.92
R1743:Ext2 UTSW 2 93730225 missense probably damaging 1.00
R1792:Ext2 UTSW 2 93704545 missense probably damaging 1.00
R2874:Ext2 UTSW 2 93739686 missense possibly damaging 0.95
R3122:Ext2 UTSW 2 93813825 missense probably damaging 1.00
R4624:Ext2 UTSW 2 93703200 missense probably benign 0.26
R4653:Ext2 UTSW 2 93696159 missense probably benign 0.22
R4826:Ext2 UTSW 2 93762630 missense probably benign 0.15
R4828:Ext2 UTSW 2 93795767 missense probably benign 0.08
R4936:Ext2 UTSW 2 93813679 nonsense probably null
R5311:Ext2 UTSW 2 93696261 missense probably benign 0.04
R5799:Ext2 UTSW 2 93811972 missense probably benign 0.01
R5850:Ext2 UTSW 2 93813659 missense possibly damaging 0.94
R6230:Ext2 UTSW 2 93762620 missense probably damaging 1.00
R6488:Ext2 UTSW 2 93806085 missense probably damaging 0.99
R7047:Ext2 UTSW 2 93739657 missense probably damaging 0.99
R7173:Ext2 UTSW 2 93813612 missense probably damaging 1.00
R7391:Ext2 UTSW 2 93730267 missense probably damaging 1.00
R7530:Ext2 UTSW 2 93661653 missense probably benign 0.00
R7545:Ext2 UTSW 2 93813763 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATCTCACAACCATGCTCCAAGTG -3'
(R):5'- AGTCTTCAGAAGCCTGTCCTGACC -3'

Sequencing Primer
(F):5'- GTGACATAAGACAGTGGCTTTTCC -3'
(R):5'- TTTTCTAGGTCTGGCGGGAA -3'
Posted On2014-04-13