Incidental Mutation 'R1538:Rgs12'
ID 169675
Institutional Source Beutler Lab
Gene Symbol Rgs12
Ensembl Gene ENSMUSG00000029101
Gene Name regulator of G-protein signaling 12
Synonyms 4632412M04Rik, 1200016K18Rik
MMRRC Submission 039577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.247) question?
Stock # R1538 (G1)
Quality Score 164
Status Not validated
Chromosome 5
Chromosomal Location 35106789-35196988 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 35178511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 779 (T779S)
Ref Sequence ENSEMBL: ENSMUSP00000084970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030984] [ENSMUST00000087684] [ENSMUST00000114280] [ENSMUST00000114281] [ENSMUST00000114283] [ENSMUST00000114284] [ENSMUST00000114285] [ENSMUST00000225237] [ENSMUST00000156339]
AlphaFold Q8CGE9
Predicted Effect probably benign
Transcript: ENSMUST00000030984
AA Change: T779S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030984
Gene: ENSMUSG00000029101
AA Change: T779S

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
low complexity region 849 865 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 911 928 N/A INTRINSIC
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
GoLoco 1187 1209 9.74e-9 SMART
low complexity region 1259 1280 N/A INTRINSIC
low complexity region 1292 1308 N/A INTRINSIC
low complexity region 1359 1378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087684
AA Change: T779S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101
AA Change: T779S

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114280
AA Change: T121S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109919
Gene: ENSMUSG00000029101
AA Change: T121S

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114281
AA Change: T121S

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109920
Gene: ENSMUSG00000029101
AA Change: T121S

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 701 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114283
AA Change: T121S

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101
AA Change: T121S

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114284
AA Change: T131S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109923
Gene: ENSMUSG00000029101
AA Change: T131S

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 711 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114285
AA Change: T131S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101
AA Change: T131S

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153972
Predicted Effect probably benign
Transcript: ENSMUST00000156819
SMART Domains Protein: ENSMUSP00000116913
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
RBD 21 91 3.12e-28 SMART
RBD 93 163 2.44e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225237
Predicted Effect probably benign
Transcript: ENSMUST00000156339
SMART Domains Protein: ENSMUSP00000115064
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Pfam:RGS 1 30 1.3e-7 PFAM
low complexity region 48 64 N/A INTRINSIC
low complexity region 67 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201936
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 'regulator of G protein signaling' (RGS) gene family. The encoded protein may function as a guanosine triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. Other alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 137,771,162 (GRCm39) R117L probably benign Het
4930447C04Rik G A 12: 72,928,120 (GRCm39) A537V possibly damaging Het
4930579F01Rik A C 3: 137,889,517 (GRCm39) D33E probably damaging Het
Acnat1 T C 4: 49,447,835 (GRCm39) K249E possibly damaging Het
Ankrd13a T C 5: 114,942,295 (GRCm39) I526T possibly damaging Het
Aplp1 C A 7: 30,135,452 (GRCm39) E535D probably benign Het
Armc8 T A 9: 99,387,343 (GRCm39) H425L probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Asprv1 C T 6: 86,605,618 (GRCm39) Q155* probably null Het
Atl1 A G 12: 69,972,962 (GRCm39) Q94R probably benign Het
Atp2a2 A G 5: 122,595,440 (GRCm39) L970P probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Bod1l A G 5: 41,973,772 (GRCm39) M2514T probably benign Het
Cacfd1 T A 2: 26,908,951 (GRCm39) D97E probably benign Het
Cacna1e A G 1: 154,437,504 (GRCm39) L344P probably damaging Het
Cacna2d2 C A 9: 107,394,615 (GRCm39) R596S probably damaging Het
Catip C A 1: 74,403,811 (GRCm39) S176* probably null Het
Cdcp1 G A 9: 123,002,653 (GRCm39) S806L probably damaging Het
Cdk6 A T 5: 3,570,675 (GRCm39) I289L probably benign Het
Cers3 C T 7: 66,431,571 (GRCm39) T182I probably damaging Het
Cfap46 T A 7: 139,262,924 (GRCm39) N43I probably null Het
Clec4n A T 6: 123,206,992 (GRCm39) R5S possibly damaging Het
Cnr2 G T 4: 135,644,012 (GRCm39) S30I probably benign Het
Col18a1 C T 10: 76,907,170 (GRCm39) G870E probably damaging Het
Cpne6 T C 14: 55,752,677 (GRCm39) V289A possibly damaging Het
Crym G A 7: 119,796,938 (GRCm39) L141F probably benign Het
Cxxc5 T C 18: 35,991,622 (GRCm39) S8P unknown Het
Dido1 A C 2: 180,326,763 (GRCm39) S453R possibly damaging Het
Dnah2 A C 11: 69,368,028 (GRCm39) S1770R probably benign Het
Dnah7a A G 1: 53,535,148 (GRCm39) V2704A possibly damaging Het
Eml5 T C 12: 98,760,535 (GRCm39) N1738S probably damaging Het
Eri3 A G 4: 117,439,836 (GRCm39) T138A possibly damaging Het
Ext2 C T 2: 93,537,632 (GRCm39) E585K probably damaging Het
Fbxw19 T A 9: 109,324,056 (GRCm39) S38C probably damaging Het
Fcgbpl1 A T 7: 27,854,917 (GRCm39) I1848F probably damaging Het
Fmo6 G A 1: 162,753,675 (GRCm39) P156S probably damaging Het
Frem3 A T 8: 81,339,764 (GRCm39) I686F probably benign Het
Frem3 T C 8: 81,339,339 (GRCm39) L544P probably damaging Het
Gabra1 T C 11: 42,031,177 (GRCm39) Y251C probably benign Het
Gemin4 G T 11: 76,101,987 (GRCm39) Q925K probably benign Het
Gm18856 T A 13: 14,139,274 (GRCm39) probably benign Het
Gnb1 A T 4: 155,636,171 (GRCm39) T164S probably benign Het
Gpx6 A G 13: 21,497,822 (GRCm39) D31G possibly damaging Het
Gzmd A C 14: 56,367,802 (GRCm39) I157S probably benign Het
Il31ra T A 13: 112,684,000 (GRCm39) N43I possibly damaging Het
Irak3 T C 10: 120,001,035 (GRCm39) T297A probably benign Het
Kank2 T C 9: 21,685,927 (GRCm39) D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,159,382 (GRCm39) probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klhl18 A G 9: 110,275,815 (GRCm39) F111S probably damaging Het
Lratd2 A G 15: 60,695,498 (GRCm39) C83R probably damaging Het
Lrp5 A G 19: 3,697,585 (GRCm39) S319P possibly damaging Het
Mettl15 T C 2: 108,962,010 (GRCm39) probably null Het
Mtarc1 T C 1: 184,534,199 (GRCm39) E223G probably damaging Het
Ncoa1 T C 12: 4,320,748 (GRCm39) Q1107R possibly damaging Het
Ncoa7 T G 10: 30,570,207 (GRCm39) M251L probably damaging Het
Nos2 A T 11: 78,847,396 (GRCm39) M1023L probably benign Het
Nup107 T C 10: 117,626,399 (GRCm39) K25E probably damaging Het
Or10q1b A T 19: 13,682,860 (GRCm39) Y223F probably damaging Het
Or52s1b A G 7: 102,822,193 (GRCm39) I217T probably damaging Het
Or5k14 T A 16: 58,693,261 (GRCm39) N84I probably damaging Het
Or5p58 T A 7: 107,694,493 (GRCm39) I95F probably damaging Het
Or6b6 A T 7: 106,571,190 (GRCm39) Y120* probably null Het
Or6c206 T C 10: 129,097,082 (GRCm39) I84T probably damaging Het
Parm1 G A 5: 91,742,306 (GRCm39) E225K possibly damaging Het
Pdzd2 A C 15: 12,373,047 (GRCm39) S2363A probably damaging Het
Piezo1 A G 8: 123,218,142 (GRCm39) L1199P probably damaging Het
Prpsap1 A T 11: 116,370,534 (GRCm39) M141K probably benign Het
Prss29 A T 17: 25,539,257 (GRCm39) M1L possibly damaging Het
Pter T A 2: 12,983,417 (GRCm39) S141T probably benign Het
Ptpru A T 4: 131,501,662 (GRCm39) D1181E probably damaging Het
Rab3ip T A 10: 116,775,159 (GRCm39) Q66H probably damaging Het
Rgs22 A G 15: 36,048,922 (GRCm39) F786S probably damaging Het
Rnasel A T 1: 153,636,540 (GRCm39) D640V possibly damaging Het
Rp1 T C 1: 4,415,899 (GRCm39) T1738A probably damaging Het
Sacs T C 14: 61,447,508 (GRCm39) S3185P probably damaging Het
Scnn1a T A 6: 125,315,856 (GRCm39) D321E possibly damaging Het
Sec31b G C 19: 44,507,025 (GRCm39) L1014V probably benign Het
Serpinb10 A G 1: 107,468,690 (GRCm39) Y111C probably damaging Het
Shld2 C G 14: 33,990,833 (GRCm39) Q24H probably damaging Het
Siglecg A G 7: 43,067,313 (GRCm39) K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 (GRCm39) I95V probably benign Het
Sirpb1b T A 3: 15,613,819 (GRCm39) T88S possibly damaging Het
Spire2 T G 8: 124,084,895 (GRCm39) L245R probably damaging Het
Stard9 C A 2: 120,527,192 (GRCm39) P1150T probably benign Het
Stat6 C A 10: 127,489,125 (GRCm39) T380N probably damaging Het
Sult3a1 G A 10: 33,746,166 (GRCm39) G162E probably benign Het
Surf4 T C 2: 26,823,710 (GRCm39) probably null Het
Tacc2 T C 7: 130,227,149 (GRCm39) M1278T probably benign Het
Tacr2 T A 10: 62,097,106 (GRCm39) probably null Het
Tcaf1 A T 6: 42,655,923 (GRCm39) V351E probably damaging Het
Tmcc2 A G 1: 132,308,718 (GRCm39) S59P probably damaging Het
Tmem17 G A 11: 22,467,266 (GRCm39) S60N possibly damaging Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tmprss7 A T 16: 45,499,753 (GRCm39) I307N probably benign Het
Treml2 A T 17: 48,609,786 (GRCm39) T73S possibly damaging Het
Trrap A G 5: 144,774,012 (GRCm39) H2876R possibly damaging Het
Tyw3 A G 3: 154,302,506 (GRCm39) I53T probably damaging Het
Ugp2 A G 11: 21,283,791 (GRCm39) I92T possibly damaging Het
Vmn2r66 A T 7: 84,644,166 (GRCm39) M748K possibly damaging Het
Vmn2r82 T C 10: 79,192,578 (GRCm39) S52P possibly damaging Het
Wdr37 A T 13: 8,886,828 (GRCm39) S320T probably benign Het
Zbtb16 A T 9: 48,743,583 (GRCm39) M243K probably benign Het
Zfr C T 15: 12,150,329 (GRCm39) T432I possibly damaging Het
Other mutations in Rgs12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rgs12 APN 5 35,132,563 (GRCm39) missense probably benign 0.25
IGL02296:Rgs12 APN 5 35,123,464 (GRCm39) missense probably damaging 0.96
IGL02337:Rgs12 APN 5 35,177,697 (GRCm39) missense probably damaging 1.00
IGL02483:Rgs12 APN 5 35,187,861 (GRCm39) missense probably damaging 1.00
IGL02869:Rgs12 APN 5 35,183,227 (GRCm39) missense probably damaging 0.97
IGL02989:Rgs12 APN 5 35,122,463 (GRCm39) missense probably damaging 1.00
R0015:Rgs12 UTSW 5 35,180,120 (GRCm39) unclassified probably benign
R0015:Rgs12 UTSW 5 35,180,120 (GRCm39) unclassified probably benign
R0046:Rgs12 UTSW 5 35,122,664 (GRCm39) missense probably damaging 1.00
R0046:Rgs12 UTSW 5 35,122,664 (GRCm39) missense probably damaging 1.00
R0106:Rgs12 UTSW 5 35,124,008 (GRCm39) missense probably benign 0.03
R0106:Rgs12 UTSW 5 35,124,008 (GRCm39) missense probably benign 0.03
R0233:Rgs12 UTSW 5 35,187,842 (GRCm39) missense probably damaging 1.00
R0233:Rgs12 UTSW 5 35,187,842 (GRCm39) missense probably damaging 1.00
R0245:Rgs12 UTSW 5 35,187,424 (GRCm39) missense probably benign 0.01
R0611:Rgs12 UTSW 5 35,176,804 (GRCm39) missense probably damaging 1.00
R0704:Rgs12 UTSW 5 35,180,466 (GRCm39) missense possibly damaging 0.95
R0723:Rgs12 UTSW 5 35,181,710 (GRCm39) unclassified probably benign
R1174:Rgs12 UTSW 5 35,123,809 (GRCm39) missense probably benign 0.00
R1556:Rgs12 UTSW 5 35,196,626 (GRCm39) missense possibly damaging 0.67
R1774:Rgs12 UTSW 5 35,123,747 (GRCm39) missense probably benign 0.34
R1791:Rgs12 UTSW 5 35,123,456 (GRCm39) missense possibly damaging 0.86
R1866:Rgs12 UTSW 5 35,123,018 (GRCm39) missense probably damaging 1.00
R1872:Rgs12 UTSW 5 35,123,165 (GRCm39) missense probably damaging 1.00
R1923:Rgs12 UTSW 5 35,189,613 (GRCm39) missense probably damaging 1.00
R2012:Rgs12 UTSW 5 35,187,872 (GRCm39) missense probably benign 0.00
R2107:Rgs12 UTSW 5 35,124,079 (GRCm39) missense possibly damaging 0.68
R3730:Rgs12 UTSW 5 35,189,595 (GRCm39) missense probably damaging 1.00
R3731:Rgs12 UTSW 5 35,189,595 (GRCm39) missense probably damaging 1.00
R3808:Rgs12 UTSW 5 35,189,698 (GRCm39) missense probably damaging 1.00
R3826:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R3827:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R3829:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R3830:Rgs12 UTSW 5 35,123,359 (GRCm39) missense possibly damaging 0.94
R4392:Rgs12 UTSW 5 35,189,655 (GRCm39) missense probably damaging 1.00
R4617:Rgs12 UTSW 5 35,177,700 (GRCm39) missense probably damaging 1.00
R5132:Rgs12 UTSW 5 35,147,156 (GRCm39) intron probably benign
R5213:Rgs12 UTSW 5 35,122,664 (GRCm39) missense probably damaging 1.00
R5296:Rgs12 UTSW 5 35,178,448 (GRCm39) unclassified probably benign
R5480:Rgs12 UTSW 5 35,123,455 (GRCm39) missense probably benign 0.09
R5510:Rgs12 UTSW 5 35,123,383 (GRCm39) missense probably damaging 1.00
R5708:Rgs12 UTSW 5 35,123,696 (GRCm39) missense probably benign 0.41
R5987:Rgs12 UTSW 5 35,177,689 (GRCm39) missense probably damaging 1.00
R6053:Rgs12 UTSW 5 35,123,296 (GRCm39) missense probably benign 0.01
R6113:Rgs12 UTSW 5 35,177,667 (GRCm39) missense probably damaging 0.99
R6401:Rgs12 UTSW 5 35,177,676 (GRCm39) missense probably damaging 1.00
R6736:Rgs12 UTSW 5 35,180,436 (GRCm39) missense probably damaging 1.00
R6807:Rgs12 UTSW 5 35,180,515 (GRCm39) missense probably null 0.27
R6857:Rgs12 UTSW 5 35,187,366 (GRCm39) nonsense probably null
R7082:Rgs12 UTSW 5 35,124,050 (GRCm39) missense probably benign 0.00
R7250:Rgs12 UTSW 5 35,122,841 (GRCm39) missense probably damaging 1.00
R7276:Rgs12 UTSW 5 35,183,715 (GRCm39) missense probably benign 0.06
R7444:Rgs12 UTSW 5 35,183,287 (GRCm39) missense possibly damaging 0.65
R7632:Rgs12 UTSW 5 35,122,934 (GRCm39) missense probably damaging 1.00
R8049:Rgs12 UTSW 5 35,183,374 (GRCm39) missense possibly damaging 0.89
R8089:Rgs12 UTSW 5 35,177,692 (GRCm39) missense probably damaging 1.00
R8241:Rgs12 UTSW 5 35,123,117 (GRCm39) missense probably damaging 1.00
R8797:Rgs12 UTSW 5 35,186,915 (GRCm39) missense
R8927:Rgs12 UTSW 5 35,123,633 (GRCm39) missense possibly damaging 0.93
R8928:Rgs12 UTSW 5 35,123,633 (GRCm39) missense possibly damaging 0.93
R9073:Rgs12 UTSW 5 35,177,753 (GRCm39) unclassified probably benign
R9211:Rgs12 UTSW 5 35,123,165 (GRCm39) missense probably damaging 0.98
R9485:Rgs12 UTSW 5 35,189,614 (GRCm39) missense probably damaging 0.99
R9550:Rgs12 UTSW 5 35,196,665 (GRCm39) missense probably damaging 0.99
Z1176:Rgs12 UTSW 5 35,123,113 (GRCm39) missense probably damaging 1.00
Z1177:Rgs12 UTSW 5 35,183,696 (GRCm39) missense probably benign 0.44
Z1177:Rgs12 UTSW 5 35,122,198 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGCCATTTAGAAATTTGCAGCC -3'
(R):5'- TTGTCACCATGCCCACATGACC -3'

Sequencing Primer
(F):5'- ACTATAGACAGGGCCTGTGACTC -3'
(R):5'- CCTTCCCAGAAGGGCAC -3'
Posted On 2014-04-13