Mutagenetix > Incidental Mutation

Incidental Mutation 'R1538:Scnn1a'

169685

Institutional Source

Beutler Lab

Gene Symbol

Scnn1a

Ensembl Gene

ENSMUSG00000030340

Gene Name

sodium channel, nonvoltage-gated 1 alpha

Synonyms

ENaC alpha, mENaC, Scnn1

MMRRC Submission

039577-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1538 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125320659-125344943 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 125338893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 321 (D321E)

Ref Sequence

ENSEMBL: ENSMUSP00000135798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000081440
AA Change: D428E

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: D428E

Domain	Start	End	E-Value	Type
low complexity region	13	18	N/A	INTRINSIC
Pfam:ASC	88	600	1.1e-93	PFAM
low complexity region	647	677	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175966

SMART Domains

Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340

Domain	Start	End	E-Value	Type
Pfam:ASC	62	264	3.5e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176110
AA Change: D402E

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: D402E

Domain	Start	End	E-Value	Type
Pfam:ASC	62	575	1.9e-112	PFAM
low complexity region	621	651	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176442
AA Change: D321E

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340
AA Change: D321E

Domain	Start	End	E-Value	Type
Pfam:ASC	1	494	6.3e-105	PFAM
low complexity region	540	570	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176655
AA Change: D321E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340
AA Change: D321E

Domain	Start	End	E-Value	Type
Pfam:ASC	1	494	6.4e-105	PFAM
low complexity region	540	570	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177329
AA Change: D402E

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: D402E

Domain	Start	End	E-Value	Type
Pfam:ASC	62	575	1.9e-112	PFAM
low complexity region	621	651	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,065,401	R117L	probably benign	Het
4930447C04Rik	G	A	12: 72,881,346	A537V	possibly damaging	Het
4930579F01Rik	A	C	3: 138,183,756	D33E	probably damaging	Het
9530053A07Rik	A	T	7: 28,155,492	I1848F	probably damaging	Het
Acnat1	T	C	4: 49,447,835	K249E	possibly damaging	Het
Ankrd13a	T	C	5: 114,804,234	I526T	possibly damaging	Het
Aplp1	C	A	7: 30,436,027	E535D	probably benign	Het
Armc8	T	A	9: 99,505,290	H425L	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asprv1	C	T	6: 86,628,636	Q155*	probably null	Het
Atl1	A	G	12: 69,926,188	Q94R	probably benign	Het
Atp2a2	A	G	5: 122,457,377	L970P	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Bod1l	A	G	5: 41,816,429	M2514T	probably benign	Het
Cacfd1	T	A	2: 27,018,939	D97E	probably benign	Het
Cacna1e	A	G	1: 154,561,758	L344P	probably damaging	Het
Cacna2d2	C	A	9: 107,517,416	R596S	probably damaging	Het
Catip	C	A	1: 74,364,652	S176*	probably null	Het
Cdcp1	G	A	9: 123,173,588	S806L	probably damaging	Het
Cdk6	A	T	5: 3,520,675	I289L	probably benign	Het
Cers3	C	T	7: 66,781,823	T182I	probably damaging	Het
Cfap46	T	A	7: 139,683,008	N43I	probably null	Het
Clec4n	A	T	6: 123,230,033	R5S	possibly damaging	Het
Cnr2	G	T	4: 135,916,701	S30I	probably benign	Het
Col18a1	C	T	10: 77,071,336	G870E	probably damaging	Het
Cpne6	T	C	14: 55,515,220	V289A	possibly damaging	Het
Crym	G	A	7: 120,197,715	L141F	probably benign	Het
Cxxc5	T	C	18: 35,858,569	S8P	unknown	Het
Dido1	A	C	2: 180,684,970	S453R	possibly damaging	Het
Dnah2	A	C	11: 69,477,202	S1770R	probably benign	Het
Dnah7a	A	G	1: 53,495,989	V2704A	possibly damaging	Het
Eml5	T	C	12: 98,794,276	N1738S	probably damaging	Het
Eri3	A	G	4: 117,582,639	T138A	possibly damaging	Het
Ext2	C	T	2: 93,707,287	E585K	probably damaging	Het
Fam35a	C	G	14: 34,268,876	Q24H	probably damaging	Het
Fam84b	A	G	15: 60,823,649	C83R	probably damaging	Het
Fbxw19	T	A	9: 109,494,988	S38C	probably damaging	Het
Fmo6	G	A	1: 162,926,106	P156S	probably damaging	Het
Frem3	T	C	8: 80,612,710	L544P	probably damaging	Het
Frem3	A	T	8: 80,613,135	I686F	probably benign	Het
Gabra1	T	C	11: 42,140,350	Y251C	probably benign	Het
Gemin4	G	T	11: 76,211,161	Q925K	probably benign	Het
Gm18856	T	A	13: 13,964,689		probably benign	Het
Gnb1	A	T	4: 155,551,714	T164S	probably benign	Het
Gpx6	A	G	13: 21,313,652	D31G	possibly damaging	Het
Gzmd	A	C	14: 56,130,345	I157S	probably benign	Het
Il31ra	T	A	13: 112,547,466	N43I	possibly damaging	Het
Irak3	T	C	10: 120,165,130	T297A	probably benign	Het
Kank2	T	C	9: 21,774,631	D649G	probably damaging	Het
Kif3b	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	2: 153,317,462		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	G	9: 110,446,747	F111S	probably damaging	Het
Lrp5	A	G	19: 3,647,585	S319P	possibly damaging	Het
Marc1	T	C	1: 184,802,002	E223G	probably damaging	Het
Mettl15	T	C	2: 109,131,665		probably null	Het
Ncoa1	T	C	12: 4,270,748	Q1107R	possibly damaging	Het
Ncoa7	T	G	10: 30,694,211	M251L	probably damaging	Het
Nos2	A	T	11: 78,956,570	M1023L	probably benign	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Olfr1491	A	T	19: 13,705,496	Y223F	probably damaging	Het
Olfr177	T	A	16: 58,872,898	N84I	probably damaging	Het
Olfr482	T	A	7: 108,095,286	I95F	probably damaging	Het
Olfr591	A	G	7: 103,172,986	I217T	probably damaging	Het
Olfr711	A	T	7: 106,971,983	Y120*	probably null	Het
Olfr776	T	C	10: 129,261,213	I84T	probably damaging	Het
Parm1	G	A	5: 91,594,447	E225K	possibly damaging	Het
Pdzd2	A	C	15: 12,372,961	S2363A	probably damaging	Het
Piezo1	A	G	8: 122,491,403	L1199P	probably damaging	Het
Prpsap1	A	T	11: 116,479,708	M141K	probably benign	Het
Prss29	A	T	17: 25,320,283	M1L	possibly damaging	Het
Pter	T	A	2: 12,978,606	S141T	probably benign	Het
Ptpru	A	T	4: 131,774,351	D1181E	probably damaging	Het
Rab3ip	T	A	10: 116,939,254	Q66H	probably damaging	Het
Rgs12	A	T	5: 35,021,167	T779S	probably damaging	Het
Rgs22	A	G	15: 36,048,776	F786S	probably damaging	Het
Rnasel	A	T	1: 153,760,794	D640V	possibly damaging	Het
Rp1	T	C	1: 4,345,676	T1738A	probably damaging	Het
Sacs	T	C	14: 61,210,059	S3185P	probably damaging	Het
Sec31b	G	C	19: 44,518,586	L1014V	probably benign	Het
Serpinb10	A	G	1: 107,540,960	Y111C	probably damaging	Het
Siglecg	A	G	7: 43,417,889	K627E	possibly damaging	Het
Sigmar1	T	C	4: 41,740,845	I95V	probably benign	Het
Sirpb1b	T	A	3: 15,548,759	T88S	possibly damaging	Het
Spire2	T	G	8: 123,358,156	L245R	probably damaging	Het
Stard9	C	A	2: 120,696,711	P1150T	probably benign	Het
Stat6	C	A	10: 127,653,256	T380N	probably damaging	Het
Sult3a1	G	A	10: 33,870,170	G162E	probably benign	Het
Surf4	T	C	2: 26,933,698		probably null	Het
Tacc2	T	C	7: 130,625,419	M1278T	probably benign	Het
Tacr2	T	A	10: 62,261,327		probably null	Het
Tcaf1	A	T	6: 42,678,989	V351E	probably damaging	Het
Tmcc2	A	G	1: 132,380,980	S59P	probably damaging	Het
Tmem17	G	A	11: 22,517,266	S60N	possibly damaging	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tmprss7	A	T	16: 45,679,390	I307N	probably benign	Het
Treml2	A	T	17: 48,302,758	T73S	possibly damaging	Het
Trrap	A	G	5: 144,837,202	H2876R	possibly damaging	Het
Tyw3	A	G	3: 154,596,869	I53T	probably damaging	Het
Ugp2	A	G	11: 21,333,791	I92T	possibly damaging	Het
Vmn2r66	A	T	7: 84,994,958	M748K	possibly damaging	Het
Vmn2r82	T	C	10: 79,356,744	S52P	possibly damaging	Het
Wdr37	A	T	13: 8,836,792	S320T	probably benign	Het
Zbtb16	A	T	9: 48,832,283	M243K	probably benign	Het
Zfr	C	T	15: 12,150,243	T432I	possibly damaging	Het

Other mutations in Scnn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Scnn1a	APN	6	125338379	missense	probably benign	0.11
IGL01793:Scnn1a	APN	6	125343703	missense	probably benign	0.03
IGL01992:Scnn1a	APN	6	125338937	critical splice donor site	probably null
IGL03280:Scnn1a	APN	6	125342781	splice site	probably benign
scylla	UTSW	6	125343245	missense	probably damaging	0.98
R0086:Scnn1a	UTSW	6	125342587	splice site	probably benign
R0442:Scnn1a	UTSW	6	125339137	missense	probably damaging	1.00
R0454:Scnn1a	UTSW	6	125322226	missense	probably damaging	1.00
R0578:Scnn1a	UTSW	6	125322244	missense	probably damaging	0.97
R1579:Scnn1a	UTSW	6	125322140	missense	probably damaging	1.00
R1803:Scnn1a	UTSW	6	125332194	missense	probably damaging	0.98
R1876:Scnn1a	UTSW	6	125338838	missense	probably benign	0.05
R2113:Scnn1a	UTSW	6	125337811	missense	possibly damaging	0.60
R2178:Scnn1a	UTSW	6	125331002	missense	probably damaging	0.96
R2960:Scnn1a	UTSW	6	125322293	missense	probably damaging	1.00
R4072:Scnn1a	UTSW	6	125338907	missense	probably damaging	1.00
R4603:Scnn1a	UTSW	6	125322160	missense	probably damaging	1.00
R4928:Scnn1a	UTSW	6	125322173	missense	probably damaging	1.00
R5436:Scnn1a	UTSW	6	125343022	missense	possibly damaging	0.94
R6812:Scnn1a	UTSW	6	125337856	missense	probably benign	0.09
R7089:Scnn1a	UTSW	6	125337807	missense	probably benign	0.05
R8371:Scnn1a	UTSW	6	125343843	missense	possibly damaging	0.83
R8372:Scnn1a	UTSW	6	125343718	missense	probably damaging	0.96
R8841:Scnn1a	UTSW	6	125343245	missense	probably damaging	0.98
R9509:Scnn1a	UTSW	6	125342641	missense	probably damaging	0.99
X0026:Scnn1a	UTSW	6	125322110	missense	probably damaging	1.00
Z1176:Scnn1a	UTSW	6	125343892	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AACCCATGCACGGCCTTGAAAG -3'
(R):5'- GTAGAAGATGTAGGCACAGCCACAC -3'

Sequencing Primer
(F):5'- CGGCCTTGAAAGTGGTACAC -3'
(R):5'- ATCATGTTCTCCTGGAAGCAG -3'

Posted On

2014-04-13