Incidental Mutation 'R1538:Zbtb16'
ID 169702
Institutional Source Beutler Lab
Gene Symbol Zbtb16
Ensembl Gene ENSMUSG00000066687
Gene Name zinc finger and BTB domain containing 16
Synonyms Green's luxoid, Zfp145, PLZF
MMRRC Submission 039577-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R1538 (G1)
Quality Score 198
Status Not validated
Chromosome 9
Chromosomal Location 48654297-48836222 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48832283 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 243 (M243K)
Ref Sequence ENSEMBL: ENSMUSP00000150887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]
AlphaFold Q3UQ17
Predicted Effect probably benign
Transcript: ENSMUST00000093852
AA Change: M243K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: M243K

DomainStartEndE-ValueType
BTB 34 126 1.41e-24 SMART
ZnF_C2H2 404 426 3.72e0 SMART
ZnF_C2H2 432 454 8.22e-2 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 490 512 1.56e-2 SMART
ZnF_C2H2 518 540 1.63e-5 SMART
ZnF_C2H2 546 568 1.95e-3 SMART
ZnF_C2H2 574 596 5.9e-3 SMART
ZnF_C2H2 602 624 2.36e-2 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216150
AA Change: M243K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,065,401 (GRCm38) R117L probably benign Het
4930447C04Rik G A 12: 72,881,346 (GRCm38) A537V possibly damaging Het
4930579F01Rik A C 3: 138,183,756 (GRCm38) D33E probably damaging Het
9530053A07Rik A T 7: 28,155,492 (GRCm38) I1848F probably damaging Het
Acnat1 T C 4: 49,447,835 (GRCm38) K249E possibly damaging Het
Ankrd13a T C 5: 114,804,234 (GRCm38) I526T possibly damaging Het
Aplp1 C A 7: 30,436,027 (GRCm38) E535D probably benign Het
Armc8 T A 9: 99,505,290 (GRCm38) H425L probably damaging Het
Arsi G A 18: 60,916,651 (GRCm38) G202E probably benign Het
Asprv1 C T 6: 86,628,636 (GRCm38) Q155* probably null Het
Atl1 A G 12: 69,926,188 (GRCm38) Q94R probably benign Het
Atp2a2 A G 5: 122,457,377 (GRCm38) L970P probably damaging Het
Atp8a2 T C 14: 59,860,270 (GRCm38) K770E probably benign Het
Bod1l A G 5: 41,816,429 (GRCm38) M2514T probably benign Het
Cacfd1 T A 2: 27,018,939 (GRCm38) D97E probably benign Het
Cacna1e A G 1: 154,561,758 (GRCm38) L344P probably damaging Het
Cacna2d2 C A 9: 107,517,416 (GRCm38) R596S probably damaging Het
Catip C A 1: 74,364,652 (GRCm38) S176* probably null Het
Cdcp1 G A 9: 123,173,588 (GRCm38) S806L probably damaging Het
Cdk6 A T 5: 3,520,675 (GRCm38) I289L probably benign Het
Cers3 C T 7: 66,781,823 (GRCm38) T182I probably damaging Het
Cfap46 T A 7: 139,683,008 (GRCm38) N43I probably null Het
Clec4n A T 6: 123,230,033 (GRCm38) R5S possibly damaging Het
Cnr2 G T 4: 135,916,701 (GRCm38) S30I probably benign Het
Col18a1 C T 10: 77,071,336 (GRCm38) G870E probably damaging Het
Cpne6 T C 14: 55,515,220 (GRCm38) V289A possibly damaging Het
Crym G A 7: 120,197,715 (GRCm38) L141F probably benign Het
Cxxc5 T C 18: 35,858,569 (GRCm38) S8P unknown Het
Dido1 A C 2: 180,684,970 (GRCm38) S453R possibly damaging Het
Dnah2 A C 11: 69,477,202 (GRCm38) S1770R probably benign Het
Dnah7a A G 1: 53,495,989 (GRCm38) V2704A possibly damaging Het
Eml5 T C 12: 98,794,276 (GRCm38) N1738S probably damaging Het
Eri3 A G 4: 117,582,639 (GRCm38) T138A possibly damaging Het
Ext2 C T 2: 93,707,287 (GRCm38) E585K probably damaging Het
Fam35a C G 14: 34,268,876 (GRCm38) Q24H probably damaging Het
Fam84b A G 15: 60,823,649 (GRCm38) C83R probably damaging Het
Fbxw19 T A 9: 109,494,988 (GRCm38) S38C probably damaging Het
Fmo6 G A 1: 162,926,106 (GRCm38) P156S probably damaging Het
Frem3 A T 8: 80,613,135 (GRCm38) I686F probably benign Het
Frem3 T C 8: 80,612,710 (GRCm38) L544P probably damaging Het
Gabra1 T C 11: 42,140,350 (GRCm38) Y251C probably benign Het
Gemin4 G T 11: 76,211,161 (GRCm38) Q925K probably benign Het
Gm18856 T A 13: 13,964,689 (GRCm38) probably benign Het
Gnb1 A T 4: 155,551,714 (GRCm38) T164S probably benign Het
Gpx6 A G 13: 21,313,652 (GRCm38) D31G possibly damaging Het
Gzmd A C 14: 56,130,345 (GRCm38) I157S probably benign Het
Il31ra T A 13: 112,547,466 (GRCm38) N43I possibly damaging Het
Irak3 T C 10: 120,165,130 (GRCm38) T297A probably benign Het
Kank2 T C 9: 21,774,631 (GRCm38) D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,317,462 (GRCm38) probably benign Het
Kirrel C T 3: 87,089,151 (GRCm38) M380I probably null Het
Klhl18 A G 9: 110,446,747 (GRCm38) F111S probably damaging Het
Lrp5 A G 19: 3,647,585 (GRCm38) S319P possibly damaging Het
Marc1 T C 1: 184,802,002 (GRCm38) E223G probably damaging Het
Mettl15 T C 2: 109,131,665 (GRCm38) probably null Het
Ncoa1 T C 12: 4,270,748 (GRCm38) Q1107R possibly damaging Het
Ncoa7 T G 10: 30,694,211 (GRCm38) M251L probably damaging Het
Nos2 A T 11: 78,956,570 (GRCm38) M1023L probably benign Het
Nup107 T C 10: 117,790,494 (GRCm38) K25E probably damaging Het
Olfr1491 A T 19: 13,705,496 (GRCm38) Y223F probably damaging Het
Olfr177 T A 16: 58,872,898 (GRCm38) N84I probably damaging Het
Olfr482 T A 7: 108,095,286 (GRCm38) I95F probably damaging Het
Olfr591 A G 7: 103,172,986 (GRCm38) I217T probably damaging Het
Olfr711 A T 7: 106,971,983 (GRCm38) Y120* probably null Het
Olfr776 T C 10: 129,261,213 (GRCm38) I84T probably damaging Het
Parm1 G A 5: 91,594,447 (GRCm38) E225K possibly damaging Het
Pdzd2 A C 15: 12,372,961 (GRCm38) S2363A probably damaging Het
Piezo1 A G 8: 122,491,403 (GRCm38) L1199P probably damaging Het
Prpsap1 A T 11: 116,479,708 (GRCm38) M141K probably benign Het
Prss29 A T 17: 25,320,283 (GRCm38) M1L possibly damaging Het
Pter T A 2: 12,978,606 (GRCm38) S141T probably benign Het
Ptpru A T 4: 131,774,351 (GRCm38) D1181E probably damaging Het
Rab3ip T A 10: 116,939,254 (GRCm38) Q66H probably damaging Het
Rgs12 A T 5: 35,021,167 (GRCm38) T779S probably damaging Het
Rgs22 A G 15: 36,048,776 (GRCm38) F786S probably damaging Het
Rnasel A T 1: 153,760,794 (GRCm38) D640V possibly damaging Het
Rp1 T C 1: 4,345,676 (GRCm38) T1738A probably damaging Het
Sacs T C 14: 61,210,059 (GRCm38) S3185P probably damaging Het
Scnn1a T A 6: 125,338,893 (GRCm38) D321E possibly damaging Het
Sec31b G C 19: 44,518,586 (GRCm38) L1014V probably benign Het
Serpinb10 A G 1: 107,540,960 (GRCm38) Y111C probably damaging Het
Siglecg A G 7: 43,417,889 (GRCm38) K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 (GRCm38) I95V probably benign Het
Sirpb1b T A 3: 15,548,759 (GRCm38) T88S possibly damaging Het
Spire2 T G 8: 123,358,156 (GRCm38) L245R probably damaging Het
Stard9 C A 2: 120,696,711 (GRCm38) P1150T probably benign Het
Stat6 C A 10: 127,653,256 (GRCm38) T380N probably damaging Het
Sult3a1 G A 10: 33,870,170 (GRCm38) G162E probably benign Het
Surf4 T C 2: 26,933,698 (GRCm38) probably null Het
Tacc2 T C 7: 130,625,419 (GRCm38) M1278T probably benign Het
Tacr2 T A 10: 62,261,327 (GRCm38) probably null Het
Tcaf1 A T 6: 42,678,989 (GRCm38) V351E probably damaging Het
Tmcc2 A G 1: 132,380,980 (GRCm38) S59P probably damaging Het
Tmem17 G A 11: 22,517,266 (GRCm38) S60N possibly damaging Het
Tmem63b C G 17: 45,678,978 (GRCm38) R88P possibly damaging Het
Tmprss7 A T 16: 45,679,390 (GRCm38) I307N probably benign Het
Treml2 A T 17: 48,302,758 (GRCm38) T73S possibly damaging Het
Trrap A G 5: 144,837,202 (GRCm38) H2876R possibly damaging Het
Tyw3 A G 3: 154,596,869 (GRCm38) I53T probably damaging Het
Ugp2 A G 11: 21,333,791 (GRCm38) I92T possibly damaging Het
Vmn2r66 A T 7: 84,994,958 (GRCm38) M748K possibly damaging Het
Vmn2r82 T C 10: 79,356,744 (GRCm38) S52P possibly damaging Het
Wdr37 A T 13: 8,836,792 (GRCm38) S320T probably benign Het
Zfr C T 15: 12,150,243 (GRCm38) T432I possibly damaging Het
Other mutations in Zbtb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Zbtb16 APN 9 48,657,183 (GRCm38) missense probably damaging 1.00
R0324:Zbtb16 UTSW 9 48,665,275 (GRCm38) missense possibly damaging 0.82
R0364:Zbtb16 UTSW 9 48,743,576 (GRCm38) splice site probably benign
R1575:Zbtb16 UTSW 9 48,832,272 (GRCm38) missense probably damaging 0.96
R1937:Zbtb16 UTSW 9 48,659,778 (GRCm38) missense probably benign
R2656:Zbtb16 UTSW 9 48,832,688 (GRCm38) missense probably damaging 1.00
R4176:Zbtb16 UTSW 9 48,659,801 (GRCm38) missense probably damaging 1.00
R4582:Zbtb16 UTSW 9 48,832,082 (GRCm38) missense probably benign
R4595:Zbtb16 UTSW 9 48,832,080 (GRCm38) missense possibly damaging 0.79
R6466:Zbtb16 UTSW 9 48,665,319 (GRCm38) missense possibly damaging 0.95
R6966:Zbtb16 UTSW 9 48,657,354 (GRCm38) missense probably damaging 1.00
R7596:Zbtb16 UTSW 9 48,832,404 (GRCm38) missense possibly damaging 0.93
R7751:Zbtb16 UTSW 9 48,743,469 (GRCm38) missense probably damaging 1.00
R7904:Zbtb16 UTSW 9 48,832,972 (GRCm38) missense probably damaging 1.00
R8922:Zbtb16 UTSW 9 48,832,557 (GRCm38) missense probably benign
Z1176:Zbtb16 UTSW 9 48,657,288 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATAATGCAGCTCTCTGGCAC -3'
(R):5'- CCGTAAGGCTCGATACCTCAAGAAC -3'

Sequencing Primer
(F):5'- ACTAGTGATGACACTGCCTCG -3'
(R):5'- TATCTCGAAGCATTCCAGCG -3'
Posted On 2014-04-13