Incidental Mutation 'R1538:Cacna2d2'
ID169704
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
MMRRC Submission 039577-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R1538 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107517416 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 596 (R596S)
Ref Sequence ENSEMBL: ENSMUSP00000130451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably damaging
Transcript: ENSMUST00000010210
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: R596S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085092
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: R596S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164988
AA Change: R596S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: R596S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166799
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: R596S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168532
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: R596S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169354
Predicted Effect probably damaging
Transcript: ENSMUST00000170737
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: R596S

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194842
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,065,401 R117L probably benign Het
4930447C04Rik G A 12: 72,881,346 A537V possibly damaging Het
4930579F01Rik A C 3: 138,183,756 D33E probably damaging Het
9530053A07Rik A T 7: 28,155,492 I1848F probably damaging Het
Acnat1 T C 4: 49,447,835 K249E possibly damaging Het
Ankrd13a T C 5: 114,804,234 I526T possibly damaging Het
Aplp1 C A 7: 30,436,027 E535D probably benign Het
Armc8 T A 9: 99,505,290 H425L probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Asprv1 C T 6: 86,628,636 Q155* probably null Het
Atl1 A G 12: 69,926,188 Q94R probably benign Het
Atp2a2 A G 5: 122,457,377 L970P probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bod1l A G 5: 41,816,429 M2514T probably benign Het
Cacfd1 T A 2: 27,018,939 D97E probably benign Het
Cacna1e A G 1: 154,561,758 L344P probably damaging Het
Catip C A 1: 74,364,652 S176* probably null Het
Cdcp1 G A 9: 123,173,588 S806L probably damaging Het
Cdk6 A T 5: 3,520,675 I289L probably benign Het
Cers3 C T 7: 66,781,823 T182I probably damaging Het
Cfap46 T A 7: 139,683,008 N43I probably null Het
Clec4n A T 6: 123,230,033 R5S possibly damaging Het
Cnr2 G T 4: 135,916,701 S30I probably benign Het
Col18a1 C T 10: 77,071,336 G870E probably damaging Het
Cpne6 T C 14: 55,515,220 V289A possibly damaging Het
Crym G A 7: 120,197,715 L141F probably benign Het
Cxxc5 T C 18: 35,858,569 S8P unknown Het
Dido1 A C 2: 180,684,970 S453R possibly damaging Het
Dnah2 A C 11: 69,477,202 S1770R probably benign Het
Dnah7a A G 1: 53,495,989 V2704A possibly damaging Het
Eml5 T C 12: 98,794,276 N1738S probably damaging Het
Eri3 A G 4: 117,582,639 T138A possibly damaging Het
Ext2 C T 2: 93,707,287 E585K probably damaging Het
Fam35a C G 14: 34,268,876 Q24H probably damaging Het
Fam84b A G 15: 60,823,649 C83R probably damaging Het
Fbxw19 T A 9: 109,494,988 S38C probably damaging Het
Fmo6 G A 1: 162,926,106 P156S probably damaging Het
Frem3 T C 8: 80,612,710 L544P probably damaging Het
Frem3 A T 8: 80,613,135 I686F probably benign Het
Gabra1 T C 11: 42,140,350 Y251C probably benign Het
Gemin4 G T 11: 76,211,161 Q925K probably benign Het
Gm18856 T A 13: 13,964,689 probably benign Het
Gnb1 A T 4: 155,551,714 T164S probably benign Het
Gpx6 A G 13: 21,313,652 D31G possibly damaging Het
Gzmd A C 14: 56,130,345 I157S probably benign Het
Il31ra T A 13: 112,547,466 N43I possibly damaging Het
Irak3 T C 10: 120,165,130 T297A probably benign Het
Kank2 T C 9: 21,774,631 D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,317,462 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl18 A G 9: 110,446,747 F111S probably damaging Het
Lrp5 A G 19: 3,647,585 S319P possibly damaging Het
Marc1 T C 1: 184,802,002 E223G probably damaging Het
Mettl15 T C 2: 109,131,665 probably null Het
Ncoa1 T C 12: 4,270,748 Q1107R possibly damaging Het
Ncoa7 T G 10: 30,694,211 M251L probably damaging Het
Nos2 A T 11: 78,956,570 M1023L probably benign Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Olfr1491 A T 19: 13,705,496 Y223F probably damaging Het
Olfr177 T A 16: 58,872,898 N84I probably damaging Het
Olfr482 T A 7: 108,095,286 I95F probably damaging Het
Olfr591 A G 7: 103,172,986 I217T probably damaging Het
Olfr711 A T 7: 106,971,983 Y120* probably null Het
Olfr776 T C 10: 129,261,213 I84T probably damaging Het
Parm1 G A 5: 91,594,447 E225K possibly damaging Het
Pdzd2 A C 15: 12,372,961 S2363A probably damaging Het
Piezo1 A G 8: 122,491,403 L1199P probably damaging Het
Prpsap1 A T 11: 116,479,708 M141K probably benign Het
Prss29 A T 17: 25,320,283 M1L possibly damaging Het
Pter T A 2: 12,978,606 S141T probably benign Het
Ptpru A T 4: 131,774,351 D1181E probably damaging Het
Rab3ip T A 10: 116,939,254 Q66H probably damaging Het
Rgs12 A T 5: 35,021,167 T779S probably damaging Het
Rgs22 A G 15: 36,048,776 F786S probably damaging Het
Rnasel A T 1: 153,760,794 D640V possibly damaging Het
Rp1 T C 1: 4,345,676 T1738A probably damaging Het
Sacs T C 14: 61,210,059 S3185P probably damaging Het
Scnn1a T A 6: 125,338,893 D321E possibly damaging Het
Sec31b G C 19: 44,518,586 L1014V probably benign Het
Serpinb10 A G 1: 107,540,960 Y111C probably damaging Het
Siglecg A G 7: 43,417,889 K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 I95V probably benign Het
Sirpb1b T A 3: 15,548,759 T88S possibly damaging Het
Spire2 T G 8: 123,358,156 L245R probably damaging Het
Stard9 C A 2: 120,696,711 P1150T probably benign Het
Stat6 C A 10: 127,653,256 T380N probably damaging Het
Sult3a1 G A 10: 33,870,170 G162E probably benign Het
Surf4 T C 2: 26,933,698 probably null Het
Tacc2 T C 7: 130,625,419 M1278T probably benign Het
Tacr2 T A 10: 62,261,327 probably null Het
Tcaf1 A T 6: 42,678,989 V351E probably damaging Het
Tmcc2 A G 1: 132,380,980 S59P probably damaging Het
Tmem17 G A 11: 22,517,266 S60N possibly damaging Het
Tmem63b C G 17: 45,678,978 R88P possibly damaging Het
Tmprss7 A T 16: 45,679,390 I307N probably benign Het
Treml2 A T 17: 48,302,758 T73S possibly damaging Het
Trrap A G 5: 144,837,202 H2876R possibly damaging Het
Tyw3 A G 3: 154,596,869 I53T probably damaging Het
Ugp2 A G 11: 21,333,791 I92T possibly damaging Het
Vmn2r66 A T 7: 84,994,958 M748K possibly damaging Het
Vmn2r82 T C 10: 79,356,744 S52P possibly damaging Het
Wdr37 A T 13: 8,836,792 S320T probably benign Het
Zbtb16 A T 9: 48,832,283 M243K probably benign Het
Zfr C T 15: 12,150,243 T432I possibly damaging Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
R7652:Cacna2d2 UTSW 9 107524198 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTTGCTACATCCCAATCTCAAGCC -3'
(R):5'- ACAGCCTATGCTGAGAGGGTCAAG -3'

Sequencing Primer
(F):5'- TGAGCCAAGTGAGTAGCCC -3'
(R):5'- tctctcccttccctgtctg -3'
Posted On2014-04-13