Mutagenetix > Incidental Mutation

Incidental Mutation 'R1538:Cacna2d2'

169704

Institutional Source

Beutler Lab

Gene Symbol

Cacna2d2

Ensembl Gene

ENSMUSG00000010066

Gene Name

calcium channel, voltage-dependent, alpha 2/delta subunit 2

Synonyms

a2d2

MMRRC Submission

039577-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.889) question?

Stock #

R1538 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107399612-107529343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 107517416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 596 (R596S)

Ref Sequence

ENSEMBL: ENSMUSP00000130451 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]

AlphaFold

Q6PHS9

Predicted Effect

probably damaging
Transcript: ENSMUST00000010210
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: R596S

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	9.9e-32	PFAM
Pfam:VGCC_alpha2	583	673	1.8e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1114	1137	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085092
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: R596S

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1120	1143	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164988
AA Change: R596S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: R596S

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	6.7e-49	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	2.4e-31	PFAM
Pfam:VGCC_alpha2	583	675	2.5e-34	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166799
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: R596S

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	8.5e-44	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	576	1.3e-32	PFAM
Pfam:VGCC_alpha2	583	675	1.4e-47	PFAM
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168532
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: R596S

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2.1e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	676	5.8e-35	PFAM
low complexity region	974	983	N/A	INTRINSIC
low complexity region	1122	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169354

Predicted Effect

probably damaging
Transcript: ENSMUST00000170737
AA Change: R596S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: R596S

Domain	Start	End	E-Value	Type
low complexity region	20	36	N/A	INTRINSIC
low complexity region	43	57	N/A	INTRINSIC
Pfam:VWA_N	144	268	2e-48	PFAM
VWA	292	467	4.93e-22	SMART
Pfam:Cache_1	488	577	1e-31	PFAM
Pfam:VGCC_alpha2	583	673	1.9e-33	PFAM
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1116	1139	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194842

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,065,401	R117L	probably benign	Het
4930447C04Rik	G	A	12: 72,881,346	A537V	possibly damaging	Het
4930579F01Rik	A	C	3: 138,183,756	D33E	probably damaging	Het
9530053A07Rik	A	T	7: 28,155,492	I1848F	probably damaging	Het
Acnat1	T	C	4: 49,447,835	K249E	possibly damaging	Het
Ankrd13a	T	C	5: 114,804,234	I526T	possibly damaging	Het
Aplp1	C	A	7: 30,436,027	E535D	probably benign	Het
Armc8	T	A	9: 99,505,290	H425L	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asprv1	C	T	6: 86,628,636	Q155*	probably null	Het
Atl1	A	G	12: 69,926,188	Q94R	probably benign	Het
Atp2a2	A	G	5: 122,457,377	L970P	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Bod1l	A	G	5: 41,816,429	M2514T	probably benign	Het
Cacfd1	T	A	2: 27,018,939	D97E	probably benign	Het
Cacna1e	A	G	1: 154,561,758	L344P	probably damaging	Het
Catip	C	A	1: 74,364,652	S176*	probably null	Het
Cdcp1	G	A	9: 123,173,588	S806L	probably damaging	Het
Cdk6	A	T	5: 3,520,675	I289L	probably benign	Het
Cers3	C	T	7: 66,781,823	T182I	probably damaging	Het
Cfap46	T	A	7: 139,683,008	N43I	probably null	Het
Clec4n	A	T	6: 123,230,033	R5S	possibly damaging	Het
Cnr2	G	T	4: 135,916,701	S30I	probably benign	Het
Col18a1	C	T	10: 77,071,336	G870E	probably damaging	Het
Cpne6	T	C	14: 55,515,220	V289A	possibly damaging	Het
Crym	G	A	7: 120,197,715	L141F	probably benign	Het
Cxxc5	T	C	18: 35,858,569	S8P	unknown	Het
Dido1	A	C	2: 180,684,970	S453R	possibly damaging	Het
Dnah2	A	C	11: 69,477,202	S1770R	probably benign	Het
Dnah7a	A	G	1: 53,495,989	V2704A	possibly damaging	Het
Eml5	T	C	12: 98,794,276	N1738S	probably damaging	Het
Eri3	A	G	4: 117,582,639	T138A	possibly damaging	Het
Ext2	C	T	2: 93,707,287	E585K	probably damaging	Het
Fam35a	C	G	14: 34,268,876	Q24H	probably damaging	Het
Fam84b	A	G	15: 60,823,649	C83R	probably damaging	Het
Fbxw19	T	A	9: 109,494,988	S38C	probably damaging	Het
Fmo6	G	A	1: 162,926,106	P156S	probably damaging	Het
Frem3	T	C	8: 80,612,710	L544P	probably damaging	Het
Frem3	A	T	8: 80,613,135	I686F	probably benign	Het
Gabra1	T	C	11: 42,140,350	Y251C	probably benign	Het
Gemin4	G	T	11: 76,211,161	Q925K	probably benign	Het
Gm18856	T	A	13: 13,964,689		probably benign	Het
Gnb1	A	T	4: 155,551,714	T164S	probably benign	Het
Gpx6	A	G	13: 21,313,652	D31G	possibly damaging	Het
Gzmd	A	C	14: 56,130,345	I157S	probably benign	Het
Il31ra	T	A	13: 112,547,466	N43I	possibly damaging	Het
Irak3	T	C	10: 120,165,130	T297A	probably benign	Het
Kank2	T	C	9: 21,774,631	D649G	probably damaging	Het
Kif3b	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	2: 153,317,462		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	G	9: 110,446,747	F111S	probably damaging	Het
Lrp5	A	G	19: 3,647,585	S319P	possibly damaging	Het
Marc1	T	C	1: 184,802,002	E223G	probably damaging	Het
Mettl15	T	C	2: 109,131,665		probably null	Het
Ncoa1	T	C	12: 4,270,748	Q1107R	possibly damaging	Het
Ncoa7	T	G	10: 30,694,211	M251L	probably damaging	Het
Nos2	A	T	11: 78,956,570	M1023L	probably benign	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Olfr1491	A	T	19: 13,705,496	Y223F	probably damaging	Het
Olfr177	T	A	16: 58,872,898	N84I	probably damaging	Het
Olfr482	T	A	7: 108,095,286	I95F	probably damaging	Het
Olfr591	A	G	7: 103,172,986	I217T	probably damaging	Het
Olfr711	A	T	7: 106,971,983	Y120*	probably null	Het
Olfr776	T	C	10: 129,261,213	I84T	probably damaging	Het
Parm1	G	A	5: 91,594,447	E225K	possibly damaging	Het
Pdzd2	A	C	15: 12,372,961	S2363A	probably damaging	Het
Piezo1	A	G	8: 122,491,403	L1199P	probably damaging	Het
Prpsap1	A	T	11: 116,479,708	M141K	probably benign	Het
Prss29	A	T	17: 25,320,283	M1L	possibly damaging	Het
Pter	T	A	2: 12,978,606	S141T	probably benign	Het
Ptpru	A	T	4: 131,774,351	D1181E	probably damaging	Het
Rab3ip	T	A	10: 116,939,254	Q66H	probably damaging	Het
Rgs12	A	T	5: 35,021,167	T779S	probably damaging	Het
Rgs22	A	G	15: 36,048,776	F786S	probably damaging	Het
Rnasel	A	T	1: 153,760,794	D640V	possibly damaging	Het
Rp1	T	C	1: 4,345,676	T1738A	probably damaging	Het
Sacs	T	C	14: 61,210,059	S3185P	probably damaging	Het
Scnn1a	T	A	6: 125,338,893	D321E	possibly damaging	Het
Sec31b	G	C	19: 44,518,586	L1014V	probably benign	Het
Serpinb10	A	G	1: 107,540,960	Y111C	probably damaging	Het
Siglecg	A	G	7: 43,417,889	K627E	possibly damaging	Het
Sigmar1	T	C	4: 41,740,845	I95V	probably benign	Het
Sirpb1b	T	A	3: 15,548,759	T88S	possibly damaging	Het
Spire2	T	G	8: 123,358,156	L245R	probably damaging	Het
Stard9	C	A	2: 120,696,711	P1150T	probably benign	Het
Stat6	C	A	10: 127,653,256	T380N	probably damaging	Het
Sult3a1	G	A	10: 33,870,170	G162E	probably benign	Het
Surf4	T	C	2: 26,933,698		probably null	Het
Tacc2	T	C	7: 130,625,419	M1278T	probably benign	Het
Tacr2	T	A	10: 62,261,327		probably null	Het
Tcaf1	A	T	6: 42,678,989	V351E	probably damaging	Het
Tmcc2	A	G	1: 132,380,980	S59P	probably damaging	Het
Tmem17	G	A	11: 22,517,266	S60N	possibly damaging	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tmprss7	A	T	16: 45,679,390	I307N	probably benign	Het
Treml2	A	T	17: 48,302,758	T73S	possibly damaging	Het
Trrap	A	G	5: 144,837,202	H2876R	possibly damaging	Het
Tyw3	A	G	3: 154,596,869	I53T	probably damaging	Het
Ugp2	A	G	11: 21,333,791	I92T	possibly damaging	Het
Vmn2r66	A	T	7: 84,994,958	M748K	possibly damaging	Het
Vmn2r82	T	C	10: 79,356,744	S52P	possibly damaging	Het
Wdr37	A	T	13: 8,836,792	S320T	probably benign	Het
Zbtb16	A	T	9: 48,832,283	M243K	probably benign	Het
Zfr	C	T	15: 12,150,243	T432I	possibly damaging	Het

Other mutations in Cacna2d2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Cacna2d2	APN	9	107514873	missense	probably damaging	1.00
IGL00425:Cacna2d2	APN	9	107527351	missense	probably damaging	1.00
IGL01294:Cacna2d2	APN	9	107514081	missense	probably damaging	1.00
IGL01969:Cacna2d2	APN	9	107509216	missense	probably benign
IGL01974:Cacna2d2	APN	9	107517422	missense	probably benign	0.00
IGL02001:Cacna2d2	APN	9	107522116	missense	probably benign
IGL02125:Cacna2d2	APN	9	107513904	nonsense	probably null
IGL02143:Cacna2d2	APN	9	107518275	splice site	probably null
IGL02150:Cacna2d2	APN	9	107527316	splice site	probably benign
IGL02213:Cacna2d2	APN	9	107514048	missense	probably damaging	1.00
IGL02220:Cacna2d2	APN	9	107514879	missense	probably damaging	1.00
IGL02238:Cacna2d2	APN	9	107513558	missense	probably damaging	0.99
IGL02466:Cacna2d2	APN	9	107465554	missense	probably damaging	1.00
IGL02569:Cacna2d2	APN	9	107514046	missense	probably damaging	0.99
IGL02571:Cacna2d2	APN	9	107525646	missense	possibly damaging	0.93
IGL02825:Cacna2d2	APN	9	107524460	missense	probably damaging	1.00
IGL03000:Cacna2d2	APN	9	107524198	splice site	probably null
IGL03064:Cacna2d2	APN	9	107509275	missense	probably damaging	1.00
Blow	UTSW	9	107513606	missense	probably null	0.90
dilemma	UTSW	9	107514864	missense	probably damaging	1.00
hera	UTSW	9	107513280	missense	probably damaging	1.00
Ionian	UTSW	9	107525376	missense	probably benign	0.05
Solomonic	UTSW	9	107524662	missense	possibly damaging	0.94
PIT4131001:Cacna2d2	UTSW	9	107524668	missense	probably damaging	1.00
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0233:Cacna2d2	UTSW	9	107514670	missense	probably damaging	0.96
R0387:Cacna2d2	UTSW	9	107513881	missense	probably damaging	1.00
R0410:Cacna2d2	UTSW	9	107524620	missense	probably damaging	1.00
R0538:Cacna2d2	UTSW	9	107524383	splice site	probably benign
R0545:Cacna2d2	UTSW	9	107525223	missense	probably damaging	1.00
R0729:Cacna2d2	UTSW	9	107517257	missense	probably benign	0.06
R1024:Cacna2d2	UTSW	9	107527050	critical splice donor site	probably null
R1750:Cacna2d2	UTSW	9	107524644	missense	probably damaging	1.00
R1774:Cacna2d2	UTSW	9	107526151	missense	probably benign	0.19
R1800:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.46
R1873:Cacna2d2	UTSW	9	107513872	missense	probably damaging	0.98
R1935:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1936:Cacna2d2	UTSW	9	107509256	missense	probably damaging	1.00
R1971:Cacna2d2	UTSW	9	107512006	missense	probably damaging	0.98
R2095:Cacna2d2	UTSW	9	107527165	missense	probably benign	0.05
R2135:Cacna2d2	UTSW	9	107526513	missense	possibly damaging	0.74
R2197:Cacna2d2	UTSW	9	107527403	missense	probably damaging	0.97
R2266:Cacna2d2	UTSW	9	107513280	missense	probably damaging	1.00
R2483:Cacna2d2	UTSW	9	107512022	missense	probably damaging	1.00
R4021:Cacna2d2	UTSW	9	107514058	missense	probably damaging	1.00
R4392:Cacna2d2	UTSW	9	107400280	missense	possibly damaging	0.47
R4629:Cacna2d2	UTSW	9	107527322	missense	probably damaging	1.00
R5053:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R5327:Cacna2d2	UTSW	9	107513606	missense	probably null	0.90
R5347:Cacna2d2	UTSW	9	107514114	missense	probably benign
R5719:Cacna2d2	UTSW	9	107524652	missense	probably benign	0.36
R5737:Cacna2d2	UTSW	9	107526747	missense	possibly damaging	0.70
R5739:Cacna2d2	UTSW	9	107512329	missense	probably benign	0.37
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6037:Cacna2d2	UTSW	9	107513539	missense	probably damaging	1.00
R6084:Cacna2d2	UTSW	9	107497521	critical splice donor site	probably null
R6170:Cacna2d2	UTSW	9	107527334	missense	probably damaging	1.00
R6254:Cacna2d2	UTSW	9	107509216	missense	probably benign
R6427:Cacna2d2	UTSW	9	107515442	missense	possibly damaging	0.67
R7652:Cacna2d2	UTSW	9	107524198	splice site	probably null
R7850:Cacna2d2	UTSW	9	107525376	missense	probably benign	0.05
R7936:Cacna2d2	UTSW	9	107524127	missense	probably damaging	1.00
R7978:Cacna2d2	UTSW	9	107518257	missense	probably benign	0.14
R8039:Cacna2d2	UTSW	9	107527433	missense	possibly damaging	0.92
R8165:Cacna2d2	UTSW	9	107525454	splice site	probably null
R8274:Cacna2d2	UTSW	9	107524662	missense	possibly damaging	0.94
R8286:Cacna2d2	UTSW	9	107514864	missense	probably damaging	1.00
R8354:Cacna2d2	UTSW	9	107524135	missense	possibly damaging	0.95
R8464:Cacna2d2	UTSW	9	107512007	missense	probably damaging	0.99
R8479:Cacna2d2	UTSW	9	107526397	critical splice donor site	probably null
R8765:Cacna2d2	UTSW	9	107517159	missense	probably damaging	1.00
R8848:Cacna2d2	UTSW	9	107514656	missense	possibly damaging	0.75
R9037:Cacna2d2	UTSW	9	107509196	missense	probably benign	0.08
R9225:Cacna2d2	UTSW	9	107526204	missense	probably benign	0.10
R9295:Cacna2d2	UTSW	9	107509220	missense	probably benign	0.02
R9372:Cacna2d2	UTSW	9	107517603	missense	probably benign	0.00
R9414:Cacna2d2	UTSW	9	107515196	missense	probably damaging	1.00
R9417:Cacna2d2	UTSW	9	107515490	nonsense	probably null
R9435:Cacna2d2	UTSW	9	107519185	missense	probably benign	0.01
R9584:Cacna2d2	UTSW	9	107400205	missense	probably damaging	0.97
R9642:Cacna2d2	UTSW	9	107515428	missense	possibly damaging	0.94
R9784:Cacna2d2	UTSW	9	107527147	missense	probably benign	0.00
Z1176:Cacna2d2	UTSW	9	107517293	missense	probably damaging	1.00
Z1176:Cacna2d2	UTSW	9	107526102	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TGTTGCTACATCCCAATCTCAAGCC -3'
(R):5'- ACAGCCTATGCTGAGAGGGTCAAG -3'

Sequencing Primer
(F):5'- TGAGCCAAGTGAGTAGCCC -3'
(R):5'- tctctcccttccctgtctg -3'

Posted On

2014-04-13