Incidental Mutation 'R1538:Tacr2'
ID 169710
Institutional Source Beutler Lab
Gene Symbol Tacr2
Ensembl Gene ENSMUSG00000020081
Gene Name tachykinin receptor 2
Synonyms Tac2r
MMRRC Submission 039577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R1538 (G1)
Quality Score 155
Status Not validated
Chromosome 10
Chromosomal Location 62088217-62101769 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 62097106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020278]
AlphaFold P30549
Predicted Effect probably null
Transcript: ENSMUST00000020278
SMART Domains Protein: ENSMUSP00000020278
Gene: ENSMUSG00000020081

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 322 1.9e-11 PFAM
Pfam:7tm_1 50 307 4e-58 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neuropeptide substance K, also referred to as neurokinin A. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 137,771,162 (GRCm39) R117L probably benign Het
4930447C04Rik G A 12: 72,928,120 (GRCm39) A537V possibly damaging Het
4930579F01Rik A C 3: 137,889,517 (GRCm39) D33E probably damaging Het
Acnat1 T C 4: 49,447,835 (GRCm39) K249E possibly damaging Het
Ankrd13a T C 5: 114,942,295 (GRCm39) I526T possibly damaging Het
Aplp1 C A 7: 30,135,452 (GRCm39) E535D probably benign Het
Armc8 T A 9: 99,387,343 (GRCm39) H425L probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Asprv1 C T 6: 86,605,618 (GRCm39) Q155* probably null Het
Atl1 A G 12: 69,972,962 (GRCm39) Q94R probably benign Het
Atp2a2 A G 5: 122,595,440 (GRCm39) L970P probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Bod1l A G 5: 41,973,772 (GRCm39) M2514T probably benign Het
Cacfd1 T A 2: 26,908,951 (GRCm39) D97E probably benign Het
Cacna1e A G 1: 154,437,504 (GRCm39) L344P probably damaging Het
Cacna2d2 C A 9: 107,394,615 (GRCm39) R596S probably damaging Het
Catip C A 1: 74,403,811 (GRCm39) S176* probably null Het
Cdcp1 G A 9: 123,002,653 (GRCm39) S806L probably damaging Het
Cdk6 A T 5: 3,570,675 (GRCm39) I289L probably benign Het
Cers3 C T 7: 66,431,571 (GRCm39) T182I probably damaging Het
Cfap46 T A 7: 139,262,924 (GRCm39) N43I probably null Het
Clec4n A T 6: 123,206,992 (GRCm39) R5S possibly damaging Het
Cnr2 G T 4: 135,644,012 (GRCm39) S30I probably benign Het
Col18a1 C T 10: 76,907,170 (GRCm39) G870E probably damaging Het
Cpne6 T C 14: 55,752,677 (GRCm39) V289A possibly damaging Het
Crym G A 7: 119,796,938 (GRCm39) L141F probably benign Het
Cxxc5 T C 18: 35,991,622 (GRCm39) S8P unknown Het
Dido1 A C 2: 180,326,763 (GRCm39) S453R possibly damaging Het
Dnah2 A C 11: 69,368,028 (GRCm39) S1770R probably benign Het
Dnah7a A G 1: 53,535,148 (GRCm39) V2704A possibly damaging Het
Eml5 T C 12: 98,760,535 (GRCm39) N1738S probably damaging Het
Eri3 A G 4: 117,439,836 (GRCm39) T138A possibly damaging Het
Ext2 C T 2: 93,537,632 (GRCm39) E585K probably damaging Het
Fbxw19 T A 9: 109,324,056 (GRCm39) S38C probably damaging Het
Fcgbpl1 A T 7: 27,854,917 (GRCm39) I1848F probably damaging Het
Fmo6 G A 1: 162,753,675 (GRCm39) P156S probably damaging Het
Frem3 A T 8: 81,339,764 (GRCm39) I686F probably benign Het
Frem3 T C 8: 81,339,339 (GRCm39) L544P probably damaging Het
Gabra1 T C 11: 42,031,177 (GRCm39) Y251C probably benign Het
Gemin4 G T 11: 76,101,987 (GRCm39) Q925K probably benign Het
Gm18856 T A 13: 14,139,274 (GRCm39) probably benign Het
Gnb1 A T 4: 155,636,171 (GRCm39) T164S probably benign Het
Gpx6 A G 13: 21,497,822 (GRCm39) D31G possibly damaging Het
Gzmd A C 14: 56,367,802 (GRCm39) I157S probably benign Het
Il31ra T A 13: 112,684,000 (GRCm39) N43I possibly damaging Het
Irak3 T C 10: 120,001,035 (GRCm39) T297A probably benign Het
Kank2 T C 9: 21,685,927 (GRCm39) D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,159,382 (GRCm39) probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klhl18 A G 9: 110,275,815 (GRCm39) F111S probably damaging Het
Lratd2 A G 15: 60,695,498 (GRCm39) C83R probably damaging Het
Lrp5 A G 19: 3,697,585 (GRCm39) S319P possibly damaging Het
Mettl15 T C 2: 108,962,010 (GRCm39) probably null Het
Mtarc1 T C 1: 184,534,199 (GRCm39) E223G probably damaging Het
Ncoa1 T C 12: 4,320,748 (GRCm39) Q1107R possibly damaging Het
Ncoa7 T G 10: 30,570,207 (GRCm39) M251L probably damaging Het
Nos2 A T 11: 78,847,396 (GRCm39) M1023L probably benign Het
Nup107 T C 10: 117,626,399 (GRCm39) K25E probably damaging Het
Or10q1b A T 19: 13,682,860 (GRCm39) Y223F probably damaging Het
Or52s1b A G 7: 102,822,193 (GRCm39) I217T probably damaging Het
Or5k14 T A 16: 58,693,261 (GRCm39) N84I probably damaging Het
Or5p58 T A 7: 107,694,493 (GRCm39) I95F probably damaging Het
Or6b6 A T 7: 106,571,190 (GRCm39) Y120* probably null Het
Or6c206 T C 10: 129,097,082 (GRCm39) I84T probably damaging Het
Parm1 G A 5: 91,742,306 (GRCm39) E225K possibly damaging Het
Pdzd2 A C 15: 12,373,047 (GRCm39) S2363A probably damaging Het
Piezo1 A G 8: 123,218,142 (GRCm39) L1199P probably damaging Het
Prpsap1 A T 11: 116,370,534 (GRCm39) M141K probably benign Het
Prss29 A T 17: 25,539,257 (GRCm39) M1L possibly damaging Het
Pter T A 2: 12,983,417 (GRCm39) S141T probably benign Het
Ptpru A T 4: 131,501,662 (GRCm39) D1181E probably damaging Het
Rab3ip T A 10: 116,775,159 (GRCm39) Q66H probably damaging Het
Rgs12 A T 5: 35,178,511 (GRCm39) T779S probably damaging Het
Rgs22 A G 15: 36,048,922 (GRCm39) F786S probably damaging Het
Rnasel A T 1: 153,636,540 (GRCm39) D640V possibly damaging Het
Rp1 T C 1: 4,415,899 (GRCm39) T1738A probably damaging Het
Sacs T C 14: 61,447,508 (GRCm39) S3185P probably damaging Het
Scnn1a T A 6: 125,315,856 (GRCm39) D321E possibly damaging Het
Sec31b G C 19: 44,507,025 (GRCm39) L1014V probably benign Het
Serpinb10 A G 1: 107,468,690 (GRCm39) Y111C probably damaging Het
Shld2 C G 14: 33,990,833 (GRCm39) Q24H probably damaging Het
Siglecg A G 7: 43,067,313 (GRCm39) K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 (GRCm39) I95V probably benign Het
Sirpb1b T A 3: 15,613,819 (GRCm39) T88S possibly damaging Het
Spire2 T G 8: 124,084,895 (GRCm39) L245R probably damaging Het
Stard9 C A 2: 120,527,192 (GRCm39) P1150T probably benign Het
Stat6 C A 10: 127,489,125 (GRCm39) T380N probably damaging Het
Sult3a1 G A 10: 33,746,166 (GRCm39) G162E probably benign Het
Surf4 T C 2: 26,823,710 (GRCm39) probably null Het
Tacc2 T C 7: 130,227,149 (GRCm39) M1278T probably benign Het
Tcaf1 A T 6: 42,655,923 (GRCm39) V351E probably damaging Het
Tmcc2 A G 1: 132,308,718 (GRCm39) S59P probably damaging Het
Tmem17 G A 11: 22,467,266 (GRCm39) S60N possibly damaging Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tmprss7 A T 16: 45,499,753 (GRCm39) I307N probably benign Het
Treml2 A T 17: 48,609,786 (GRCm39) T73S possibly damaging Het
Trrap A G 5: 144,774,012 (GRCm39) H2876R possibly damaging Het
Tyw3 A G 3: 154,302,506 (GRCm39) I53T probably damaging Het
Ugp2 A G 11: 21,283,791 (GRCm39) I92T possibly damaging Het
Vmn2r66 A T 7: 84,644,166 (GRCm39) M748K possibly damaging Het
Vmn2r82 T C 10: 79,192,578 (GRCm39) S52P possibly damaging Het
Wdr37 A T 13: 8,886,828 (GRCm39) S320T probably benign Het
Zbtb16 A T 9: 48,743,583 (GRCm39) M243K probably benign Het
Zfr C T 15: 12,150,329 (GRCm39) T432I possibly damaging Het
Other mutations in Tacr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Tacr2 APN 10 62,097,469 (GRCm39) splice site probably benign
R3161:Tacr2 UTSW 10 62,101,024 (GRCm39) missense probably benign 0.16
R3162:Tacr2 UTSW 10 62,101,024 (GRCm39) missense probably benign 0.16
R3162:Tacr2 UTSW 10 62,101,024 (GRCm39) missense probably benign 0.16
R3889:Tacr2 UTSW 10 62,100,865 (GRCm39) missense probably damaging 1.00
R4193:Tacr2 UTSW 10 62,088,958 (GRCm39) missense probably damaging 1.00
R4801:Tacr2 UTSW 10 62,097,327 (GRCm39) missense probably damaging 1.00
R4802:Tacr2 UTSW 10 62,097,327 (GRCm39) missense probably damaging 1.00
R5382:Tacr2 UTSW 10 62,097,276 (GRCm39) missense probably damaging 1.00
R5751:Tacr2 UTSW 10 62,088,769 (GRCm39) missense probably damaging 0.98
R7064:Tacr2 UTSW 10 62,097,276 (GRCm39) missense probably damaging 1.00
R7412:Tacr2 UTSW 10 62,097,427 (GRCm39) nonsense probably null
R8335:Tacr2 UTSW 10 62,100,946 (GRCm39) missense probably benign 0.41
R8723:Tacr2 UTSW 10 62,094,107 (GRCm39) missense probably damaging 1.00
R8755:Tacr2 UTSW 10 62,088,733 (GRCm39) missense possibly damaging 0.94
Z1177:Tacr2 UTSW 10 62,094,023 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGAGGAAAGCCCAGCATTAAC -3'
(R):5'- GCCAGCAGATGGCAAATGTCAC -3'

Sequencing Primer
(F):5'- TCTTTAAACCGAACTCCAGGGTG -3'
(R):5'- GATGGCAAATGTCACCACCAC -3'
Posted On 2014-04-13