Mutagenetix > Incidental Mutation

Incidental Mutation 'R1538:Eml5'

169730

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

039577-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.225) question?

Stock #

R1538 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98794276 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1738 (N1738S)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065716
AA Change: N1691S

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: N1691S

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220848

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221902

Predicted Effect

probably benign
Transcript: ENSMUST00000222097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222717

Predicted Effect

probably damaging
Transcript: ENSMUST00000223282
AA Change: N1738S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,065,401	R117L	probably benign	Het
4930447C04Rik	G	A	12: 72,881,346	A537V	possibly damaging	Het
4930579F01Rik	A	C	3: 138,183,756	D33E	probably damaging	Het
9530053A07Rik	A	T	7: 28,155,492	I1848F	probably damaging	Het
Acnat1	T	C	4: 49,447,835	K249E	possibly damaging	Het
Ankrd13a	T	C	5: 114,804,234	I526T	possibly damaging	Het
Aplp1	C	A	7: 30,436,027	E535D	probably benign	Het
Armc8	T	A	9: 99,505,290	H425L	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asprv1	C	T	6: 86,628,636	Q155*	probably null	Het
Atl1	A	G	12: 69,926,188	Q94R	probably benign	Het
Atp2a2	A	G	5: 122,457,377	L970P	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Bod1l	A	G	5: 41,816,429	M2514T	probably benign	Het
Cacfd1	T	A	2: 27,018,939	D97E	probably benign	Het
Cacna1e	A	G	1: 154,561,758	L344P	probably damaging	Het
Cacna2d2	C	A	9: 107,517,416	R596S	probably damaging	Het
Catip	C	A	1: 74,364,652	S176*	probably null	Het
Cdcp1	G	A	9: 123,173,588	S806L	probably damaging	Het
Cdk6	A	T	5: 3,520,675	I289L	probably benign	Het
Cers3	C	T	7: 66,781,823	T182I	probably damaging	Het
Cfap46	T	A	7: 139,683,008	N43I	probably null	Het
Clec4n	A	T	6: 123,230,033	R5S	possibly damaging	Het
Cnr2	G	T	4: 135,916,701	S30I	probably benign	Het
Col18a1	C	T	10: 77,071,336	G870E	probably damaging	Het
Cpne6	T	C	14: 55,515,220	V289A	possibly damaging	Het
Crym	G	A	7: 120,197,715	L141F	probably benign	Het
Cxxc5	T	C	18: 35,858,569	S8P	unknown	Het
Dido1	A	C	2: 180,684,970	S453R	possibly damaging	Het
Dnah2	A	C	11: 69,477,202	S1770R	probably benign	Het
Dnah7a	A	G	1: 53,495,989	V2704A	possibly damaging	Het
Eri3	A	G	4: 117,582,639	T138A	possibly damaging	Het
Ext2	C	T	2: 93,707,287	E585K	probably damaging	Het
Fam35a	C	G	14: 34,268,876	Q24H	probably damaging	Het
Fam84b	A	G	15: 60,823,649	C83R	probably damaging	Het
Fbxw19	T	A	9: 109,494,988	S38C	probably damaging	Het
Fmo6	G	A	1: 162,926,106	P156S	probably damaging	Het
Frem3	T	C	8: 80,612,710	L544P	probably damaging	Het
Frem3	A	T	8: 80,613,135	I686F	probably benign	Het
Gabra1	T	C	11: 42,140,350	Y251C	probably benign	Het
Gemin4	G	T	11: 76,211,161	Q925K	probably benign	Het
Gm18856	T	A	13: 13,964,689		probably benign	Het
Gnb1	A	T	4: 155,551,714	T164S	probably benign	Het
Gpx6	A	G	13: 21,313,652	D31G	possibly damaging	Het
Gzmd	A	C	14: 56,130,345	I157S	probably benign	Het
Il31ra	T	A	13: 112,547,466	N43I	possibly damaging	Het
Irak3	T	C	10: 120,165,130	T297A	probably benign	Het
Kank2	T	C	9: 21,774,631	D649G	probably damaging	Het
Kif3b	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	2: 153,317,462		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	G	9: 110,446,747	F111S	probably damaging	Het
Lrp5	A	G	19: 3,647,585	S319P	possibly damaging	Het
Marc1	T	C	1: 184,802,002	E223G	probably damaging	Het
Mettl15	T	C	2: 109,131,665		probably null	Het
Ncoa1	T	C	12: 4,270,748	Q1107R	possibly damaging	Het
Ncoa7	T	G	10: 30,694,211	M251L	probably damaging	Het
Nos2	A	T	11: 78,956,570	M1023L	probably benign	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Olfr1491	A	T	19: 13,705,496	Y223F	probably damaging	Het
Olfr177	T	A	16: 58,872,898	N84I	probably damaging	Het
Olfr482	T	A	7: 108,095,286	I95F	probably damaging	Het
Olfr591	A	G	7: 103,172,986	I217T	probably damaging	Het
Olfr711	A	T	7: 106,971,983	Y120*	probably null	Het
Olfr776	T	C	10: 129,261,213	I84T	probably damaging	Het
Parm1	G	A	5: 91,594,447	E225K	possibly damaging	Het
Pdzd2	A	C	15: 12,372,961	S2363A	probably damaging	Het
Piezo1	A	G	8: 122,491,403	L1199P	probably damaging	Het
Prpsap1	A	T	11: 116,479,708	M141K	probably benign	Het
Prss29	A	T	17: 25,320,283	M1L	possibly damaging	Het
Pter	T	A	2: 12,978,606	S141T	probably benign	Het
Ptpru	A	T	4: 131,774,351	D1181E	probably damaging	Het
Rab3ip	T	A	10: 116,939,254	Q66H	probably damaging	Het
Rgs12	A	T	5: 35,021,167	T779S	probably damaging	Het
Rgs22	A	G	15: 36,048,776	F786S	probably damaging	Het
Rnasel	A	T	1: 153,760,794	D640V	possibly damaging	Het
Rp1	T	C	1: 4,345,676	T1738A	probably damaging	Het
Sacs	T	C	14: 61,210,059	S3185P	probably damaging	Het
Scnn1a	T	A	6: 125,338,893	D321E	possibly damaging	Het
Sec31b	G	C	19: 44,518,586	L1014V	probably benign	Het
Serpinb10	A	G	1: 107,540,960	Y111C	probably damaging	Het
Siglecg	A	G	7: 43,417,889	K627E	possibly damaging	Het
Sigmar1	T	C	4: 41,740,845	I95V	probably benign	Het
Sirpb1b	T	A	3: 15,548,759	T88S	possibly damaging	Het
Spire2	T	G	8: 123,358,156	L245R	probably damaging	Het
Stard9	C	A	2: 120,696,711	P1150T	probably benign	Het
Stat6	C	A	10: 127,653,256	T380N	probably damaging	Het
Sult3a1	G	A	10: 33,870,170	G162E	probably benign	Het
Surf4	T	C	2: 26,933,698		probably null	Het
Tacc2	T	C	7: 130,625,419	M1278T	probably benign	Het
Tacr2	T	A	10: 62,261,327		probably null	Het
Tcaf1	A	T	6: 42,678,989	V351E	probably damaging	Het
Tmcc2	A	G	1: 132,380,980	S59P	probably damaging	Het
Tmem17	G	A	11: 22,517,266	S60N	possibly damaging	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tmprss7	A	T	16: 45,679,390	I307N	probably benign	Het
Treml2	A	T	17: 48,302,758	T73S	possibly damaging	Het
Trrap	A	G	5: 144,837,202	H2876R	possibly damaging	Het
Tyw3	A	G	3: 154,596,869	I53T	probably damaging	Het
Ugp2	A	G	11: 21,333,791	I92T	possibly damaging	Het
Vmn2r66	A	T	7: 84,994,958	M748K	possibly damaging	Het
Vmn2r82	T	C	10: 79,356,744	S52P	possibly damaging	Het
Wdr37	A	T	13: 8,836,792	S320T	probably benign	Het
Zbtb16	A	T	9: 48,832,283	M243K	probably benign	Het
Zfr	C	T	15: 12,150,243	T432I	possibly damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTCAAAGGCATGAAGCCATAGG -3'
(R):5'- CCTTTCTGCTGCTGAAGATGGGAC -3'

Sequencing Primer
(F):5'- gccataggtatggtttccCC -3'
(R):5'- AGTGAGACTCTGGGACATTGC -3'

Posted On

2014-04-13