Incidental Mutation 'R1538:Eml5'
ID 169730
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 039577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R1538 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 98753064-98867743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98760535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1738 (N1738S)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000065716
AA Change: N1691S

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: N1691S

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221902
Predicted Effect probably benign
Transcript: ENSMUST00000222097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222717
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: N1738S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 137,771,162 (GRCm39) R117L probably benign Het
4930447C04Rik G A 12: 72,928,120 (GRCm39) A537V possibly damaging Het
4930579F01Rik A C 3: 137,889,517 (GRCm39) D33E probably damaging Het
Acnat1 T C 4: 49,447,835 (GRCm39) K249E possibly damaging Het
Ankrd13a T C 5: 114,942,295 (GRCm39) I526T possibly damaging Het
Aplp1 C A 7: 30,135,452 (GRCm39) E535D probably benign Het
Armc8 T A 9: 99,387,343 (GRCm39) H425L probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Asprv1 C T 6: 86,605,618 (GRCm39) Q155* probably null Het
Atl1 A G 12: 69,972,962 (GRCm39) Q94R probably benign Het
Atp2a2 A G 5: 122,595,440 (GRCm39) L970P probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Bod1l A G 5: 41,973,772 (GRCm39) M2514T probably benign Het
Cacfd1 T A 2: 26,908,951 (GRCm39) D97E probably benign Het
Cacna1e A G 1: 154,437,504 (GRCm39) L344P probably damaging Het
Cacna2d2 C A 9: 107,394,615 (GRCm39) R596S probably damaging Het
Catip C A 1: 74,403,811 (GRCm39) S176* probably null Het
Cdcp1 G A 9: 123,002,653 (GRCm39) S806L probably damaging Het
Cdk6 A T 5: 3,570,675 (GRCm39) I289L probably benign Het
Cers3 C T 7: 66,431,571 (GRCm39) T182I probably damaging Het
Cfap46 T A 7: 139,262,924 (GRCm39) N43I probably null Het
Clec4n A T 6: 123,206,992 (GRCm39) R5S possibly damaging Het
Cnr2 G T 4: 135,644,012 (GRCm39) S30I probably benign Het
Col18a1 C T 10: 76,907,170 (GRCm39) G870E probably damaging Het
Cpne6 T C 14: 55,752,677 (GRCm39) V289A possibly damaging Het
Crym G A 7: 119,796,938 (GRCm39) L141F probably benign Het
Cxxc5 T C 18: 35,991,622 (GRCm39) S8P unknown Het
Dido1 A C 2: 180,326,763 (GRCm39) S453R possibly damaging Het
Dnah2 A C 11: 69,368,028 (GRCm39) S1770R probably benign Het
Dnah7a A G 1: 53,535,148 (GRCm39) V2704A possibly damaging Het
Eri3 A G 4: 117,439,836 (GRCm39) T138A possibly damaging Het
Ext2 C T 2: 93,537,632 (GRCm39) E585K probably damaging Het
Fbxw19 T A 9: 109,324,056 (GRCm39) S38C probably damaging Het
Fcgbpl1 A T 7: 27,854,917 (GRCm39) I1848F probably damaging Het
Fmo6 G A 1: 162,753,675 (GRCm39) P156S probably damaging Het
Frem3 A T 8: 81,339,764 (GRCm39) I686F probably benign Het
Frem3 T C 8: 81,339,339 (GRCm39) L544P probably damaging Het
Gabra1 T C 11: 42,031,177 (GRCm39) Y251C probably benign Het
Gemin4 G T 11: 76,101,987 (GRCm39) Q925K probably benign Het
Gm18856 T A 13: 14,139,274 (GRCm39) probably benign Het
Gnb1 A T 4: 155,636,171 (GRCm39) T164S probably benign Het
Gpx6 A G 13: 21,497,822 (GRCm39) D31G possibly damaging Het
Gzmd A C 14: 56,367,802 (GRCm39) I157S probably benign Het
Il31ra T A 13: 112,684,000 (GRCm39) N43I possibly damaging Het
Irak3 T C 10: 120,001,035 (GRCm39) T297A probably benign Het
Kank2 T C 9: 21,685,927 (GRCm39) D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,159,382 (GRCm39) probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klhl18 A G 9: 110,275,815 (GRCm39) F111S probably damaging Het
Lratd2 A G 15: 60,695,498 (GRCm39) C83R probably damaging Het
Lrp5 A G 19: 3,697,585 (GRCm39) S319P possibly damaging Het
Mettl15 T C 2: 108,962,010 (GRCm39) probably null Het
Mtarc1 T C 1: 184,534,199 (GRCm39) E223G probably damaging Het
Ncoa1 T C 12: 4,320,748 (GRCm39) Q1107R possibly damaging Het
Ncoa7 T G 10: 30,570,207 (GRCm39) M251L probably damaging Het
Nos2 A T 11: 78,847,396 (GRCm39) M1023L probably benign Het
Nup107 T C 10: 117,626,399 (GRCm39) K25E probably damaging Het
Or10q1b A T 19: 13,682,860 (GRCm39) Y223F probably damaging Het
Or52s1b A G 7: 102,822,193 (GRCm39) I217T probably damaging Het
Or5k14 T A 16: 58,693,261 (GRCm39) N84I probably damaging Het
Or5p58 T A 7: 107,694,493 (GRCm39) I95F probably damaging Het
Or6b6 A T 7: 106,571,190 (GRCm39) Y120* probably null Het
Or6c206 T C 10: 129,097,082 (GRCm39) I84T probably damaging Het
Parm1 G A 5: 91,742,306 (GRCm39) E225K possibly damaging Het
Pdzd2 A C 15: 12,373,047 (GRCm39) S2363A probably damaging Het
Piezo1 A G 8: 123,218,142 (GRCm39) L1199P probably damaging Het
Prpsap1 A T 11: 116,370,534 (GRCm39) M141K probably benign Het
Prss29 A T 17: 25,539,257 (GRCm39) M1L possibly damaging Het
Pter T A 2: 12,983,417 (GRCm39) S141T probably benign Het
Ptpru A T 4: 131,501,662 (GRCm39) D1181E probably damaging Het
Rab3ip T A 10: 116,775,159 (GRCm39) Q66H probably damaging Het
Rgs12 A T 5: 35,178,511 (GRCm39) T779S probably damaging Het
Rgs22 A G 15: 36,048,922 (GRCm39) F786S probably damaging Het
Rnasel A T 1: 153,636,540 (GRCm39) D640V possibly damaging Het
Rp1 T C 1: 4,415,899 (GRCm39) T1738A probably damaging Het
Sacs T C 14: 61,447,508 (GRCm39) S3185P probably damaging Het
Scnn1a T A 6: 125,315,856 (GRCm39) D321E possibly damaging Het
Sec31b G C 19: 44,507,025 (GRCm39) L1014V probably benign Het
Serpinb10 A G 1: 107,468,690 (GRCm39) Y111C probably damaging Het
Shld2 C G 14: 33,990,833 (GRCm39) Q24H probably damaging Het
Siglecg A G 7: 43,067,313 (GRCm39) K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 (GRCm39) I95V probably benign Het
Sirpb1b T A 3: 15,613,819 (GRCm39) T88S possibly damaging Het
Spire2 T G 8: 124,084,895 (GRCm39) L245R probably damaging Het
Stard9 C A 2: 120,527,192 (GRCm39) P1150T probably benign Het
Stat6 C A 10: 127,489,125 (GRCm39) T380N probably damaging Het
Sult3a1 G A 10: 33,746,166 (GRCm39) G162E probably benign Het
Surf4 T C 2: 26,823,710 (GRCm39) probably null Het
Tacc2 T C 7: 130,227,149 (GRCm39) M1278T probably benign Het
Tacr2 T A 10: 62,097,106 (GRCm39) probably null Het
Tcaf1 A T 6: 42,655,923 (GRCm39) V351E probably damaging Het
Tmcc2 A G 1: 132,308,718 (GRCm39) S59P probably damaging Het
Tmem17 G A 11: 22,467,266 (GRCm39) S60N possibly damaging Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tmprss7 A T 16: 45,499,753 (GRCm39) I307N probably benign Het
Treml2 A T 17: 48,609,786 (GRCm39) T73S possibly damaging Het
Trrap A G 5: 144,774,012 (GRCm39) H2876R possibly damaging Het
Tyw3 A G 3: 154,302,506 (GRCm39) I53T probably damaging Het
Ugp2 A G 11: 21,283,791 (GRCm39) I92T possibly damaging Het
Vmn2r66 A T 7: 84,644,166 (GRCm39) M748K possibly damaging Het
Vmn2r82 T C 10: 79,192,578 (GRCm39) S52P possibly damaging Het
Wdr37 A T 13: 8,886,828 (GRCm39) S320T probably benign Het
Zbtb16 A T 9: 48,743,583 (GRCm39) M243K probably benign Het
Zfr C T 15: 12,150,329 (GRCm39) T432I possibly damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98,839,468 (GRCm39) splice site probably benign
IGL00473:Eml5 APN 12 98,771,751 (GRCm39) splice site probably benign
IGL01120:Eml5 APN 12 98,810,278 (GRCm39) missense probably benign
IGL01308:Eml5 APN 12 98,768,572 (GRCm39) missense probably damaging 1.00
IGL01790:Eml5 APN 12 98,765,191 (GRCm39) missense probably damaging 1.00
IGL01973:Eml5 APN 12 98,829,539 (GRCm39) missense probably benign
IGL02182:Eml5 APN 12 98,768,581 (GRCm39) missense probably damaging 1.00
IGL02201:Eml5 APN 12 98,760,683 (GRCm39) splice site probably benign
IGL02375:Eml5 APN 12 98,810,346 (GRCm39) missense probably damaging 1.00
IGL02397:Eml5 APN 12 98,756,933 (GRCm39) missense probably benign 0.07
IGL02480:Eml5 APN 12 98,842,502 (GRCm39) missense probably damaging 1.00
IGL02801:Eml5 APN 12 98,784,104 (GRCm39) missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98,825,100 (GRCm39) missense probably damaging 1.00
IGL03104:Eml5 APN 12 98,827,504 (GRCm39) nonsense probably null
IGL03158:Eml5 APN 12 98,793,773 (GRCm39) splice site probably benign
IGL03286:Eml5 APN 12 98,826,762 (GRCm39) missense probably damaging 1.00
IGL03380:Eml5 APN 12 98,840,906 (GRCm39) splice site probably benign
BB010:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98,791,031 (GRCm39) splice site probably null
R0624:Eml5 UTSW 12 98,831,738 (GRCm39) missense probably damaging 1.00
R0993:Eml5 UTSW 12 98,827,442 (GRCm39) missense probably benign 0.25
R1073:Eml5 UTSW 12 98,797,232 (GRCm39) missense probably damaging 1.00
R1183:Eml5 UTSW 12 98,758,305 (GRCm39) missense probably benign 0.31
R1352:Eml5 UTSW 12 98,797,262 (GRCm39) splice site probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1469:Eml5 UTSW 12 98,825,082 (GRCm39) missense probably benign
R1503:Eml5 UTSW 12 98,797,433 (GRCm39) missense probably damaging 0.99
R1689:Eml5 UTSW 12 98,797,194 (GRCm39) missense probably damaging 1.00
R1773:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1775:Eml5 UTSW 12 98,818,963 (GRCm39) splice site probably null
R1791:Eml5 UTSW 12 98,853,315 (GRCm39) missense probably benign 0.31
R1856:Eml5 UTSW 12 98,776,843 (GRCm39) missense probably damaging 1.00
R1919:Eml5 UTSW 12 98,765,098 (GRCm39) missense probably damaging 1.00
R1957:Eml5 UTSW 12 98,826,220 (GRCm39) missense probably damaging 1.00
R1962:Eml5 UTSW 12 98,842,570 (GRCm39) missense probably damaging 0.99
R2033:Eml5 UTSW 12 98,757,645 (GRCm39) missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98,760,525 (GRCm39) missense probably benign 0.33
R2073:Eml5 UTSW 12 98,768,705 (GRCm39) missense probably damaging 0.99
R2143:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2144:Eml5 UTSW 12 98,776,864 (GRCm39) missense probably damaging 1.00
R2158:Eml5 UTSW 12 98,810,205 (GRCm39) splice site probably benign
R2164:Eml5 UTSW 12 98,853,356 (GRCm39) missense probably damaging 0.99
R2175:Eml5 UTSW 12 98,842,482 (GRCm39) nonsense probably null
R2200:Eml5 UTSW 12 98,791,676 (GRCm39) missense probably damaging 1.00
R2234:Eml5 UTSW 12 98,807,840 (GRCm39) missense probably damaging 1.00
R2504:Eml5 UTSW 12 98,810,364 (GRCm39) missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2871:Eml5 UTSW 12 98,831,660 (GRCm39) missense probably damaging 1.00
R2958:Eml5 UTSW 12 98,842,437 (GRCm39) missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98,847,067 (GRCm39) splice site probably null
R3118:Eml5 UTSW 12 98,831,753 (GRCm39) missense probably damaging 0.97
R3735:Eml5 UTSW 12 98,822,248 (GRCm39) missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98,782,283 (GRCm39) missense probably damaging 1.00
R3900:Eml5 UTSW 12 98,791,782 (GRCm39) missense probably damaging 1.00
R3973:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R3976:Eml5 UTSW 12 98,768,724 (GRCm39) splice site probably benign
R4105:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4107:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4108:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4109:Eml5 UTSW 12 98,807,807 (GRCm39) splice site probably null
R4258:Eml5 UTSW 12 98,831,693 (GRCm39) missense probably benign 0.01
R4381:Eml5 UTSW 12 98,782,214 (GRCm39) missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98,803,600 (GRCm39) missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98,765,111 (GRCm39) missense probably damaging 1.00
R4775:Eml5 UTSW 12 98,768,566 (GRCm39) missense probably benign 0.05
R4850:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5007:Eml5 UTSW 12 98,797,224 (GRCm39) missense probably damaging 1.00
R5092:Eml5 UTSW 12 98,758,875 (GRCm39) missense probably damaging 1.00
R5123:Eml5 UTSW 12 98,840,771 (GRCm39) missense probably damaging 1.00
R5124:Eml5 UTSW 12 98,758,301 (GRCm39) missense probably damaging 1.00
R5273:Eml5 UTSW 12 98,756,947 (GRCm39) missense probably damaging 1.00
R5369:Eml5 UTSW 12 98,825,042 (GRCm39) missense probably damaging 1.00
R5430:Eml5 UTSW 12 98,760,417 (GRCm39) missense probably damaging 1.00
R5748:Eml5 UTSW 12 98,791,814 (GRCm39) missense probably damaging 0.99
R5769:Eml5 UTSW 12 98,756,878 (GRCm39) missense probably damaging 1.00
R5832:Eml5 UTSW 12 98,842,447 (GRCm39) missense probably benign
R6113:Eml5 UTSW 12 98,790,933 (GRCm39) nonsense probably null
R6131:Eml5 UTSW 12 98,827,510 (GRCm39) missense probably damaging 0.99
R6175:Eml5 UTSW 12 98,760,715 (GRCm39) missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98,829,388 (GRCm39) missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98,837,143 (GRCm39) missense probably damaging 0.98
R6375:Eml5 UTSW 12 98,765,127 (GRCm39)
R6528:Eml5 UTSW 12 98,790,896 (GRCm39) missense probably benign 0.18
R6657:Eml5 UTSW 12 98,757,664 (GRCm39) missense probably damaging 0.98
R6717:Eml5 UTSW 12 98,793,765 (GRCm39) missense probably damaging 1.00
R6751:Eml5 UTSW 12 98,831,659 (GRCm39) missense probably damaging 1.00
R6833:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6834:Eml5 UTSW 12 98,853,283 (GRCm39) missense probably damaging 1.00
R6972:Eml5 UTSW 12 98,842,439 (GRCm39) missense probably benign 0.00
R7091:Eml5 UTSW 12 98,768,733 (GRCm39) missense probably benign 0.16
R7353:Eml5 UTSW 12 98,791,683 (GRCm39) missense
R7644:Eml5 UTSW 12 98,822,203 (GRCm39) missense probably benign 0.05
R7694:Eml5 UTSW 12 98,758,822 (GRCm39) missense probably damaging 0.99
R7842:Eml5 UTSW 12 98,760,394 (GRCm39) missense probably damaging 1.00
R7933:Eml5 UTSW 12 98,810,279 (GRCm39) missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98,758,773 (GRCm39) critical splice donor site probably null
R8198:Eml5 UTSW 12 98,825,145 (GRCm39) nonsense probably null
R8482:Eml5 UTSW 12 98,842,560 (GRCm39) missense probably damaging 1.00
R8732:Eml5 UTSW 12 98,782,218 (GRCm39) missense probably damaging 0.99
R8956:Eml5 UTSW 12 98,818,952 (GRCm39) missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98,776,829 (GRCm39) missense probably damaging 0.99
R9131:Eml5 UTSW 12 98,825,099 (GRCm39) missense probably damaging 1.00
R9258:Eml5 UTSW 12 98,810,376 (GRCm39) missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98,822,287 (GRCm39) missense probably damaging 0.99
R9276:Eml5 UTSW 12 98,765,060 (GRCm39) missense probably damaging 0.99
R9301:Eml5 UTSW 12 98,848,292 (GRCm39) nonsense probably null
R9368:Eml5 UTSW 12 98,762,837 (GRCm39) missense probably benign 0.31
R9392:Eml5 UTSW 12 98,867,199 (GRCm39) missense probably damaging 1.00
R9393:Eml5 UTSW 12 98,842,433 (GRCm39) missense probably benign 0.35
R9449:Eml5 UTSW 12 98,827,554 (GRCm39) missense probably damaging 1.00
R9570:Eml5 UTSW 12 98,782,243 (GRCm39) missense probably benign 0.15
T0722:Eml5 UTSW 12 98,807,841 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCAAAGGCATGAAGCCATAGG -3'
(R):5'- CCTTTCTGCTGCTGAAGATGGGAC -3'

Sequencing Primer
(F):5'- gccataggtatggtttccCC -3'
(R):5'- AGTGAGACTCTGGGACATTGC -3'
Posted On 2014-04-13