Mutagenetix > Incidental Mutation

Incidental Mutation 'R1538:Zfr'

169740

Institutional Source

Beutler Lab

Gene Symbol

Zfr

Ensembl Gene

ENSMUSG00000022201

Gene Name

zinc finger RNA binding protein

Synonyms

MMRRC Submission

039577-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1538 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12117831-12185683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 12150243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 432 (T432I)

Ref Sequence

ENSEMBL: ENSMUSP00000118911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122941] [ENSMUST00000128475]

AlphaFold

O88532

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122941
AA Change: T432I

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118911
Gene: ENSMUSG00000022201
AA Change: T432I

Domain	Start	End	E-Value	Type
low complexity region	69	116	N/A	INTRINSIC
low complexity region	159	182	N/A	INTRINSIC
low complexity region	196	224	N/A	INTRINSIC
low complexity region	229	302	N/A	INTRINSIC
ZnF_U1	328	362	7.79e-6	SMART
ZnF_C2H2	331	355	4.94e0	SMART
ZnF_U1	379	413	1.84e-7	SMART
ZnF_C2H2	382	406	4.65e-1	SMART
low complexity region	429	448	N/A	INTRINSIC
low complexity region	468	483	N/A	INTRINSIC
ZnF_U1	579	613	2.01e-8	SMART
ZnF_C2H2	582	606	1.31e0	SMART
low complexity region	630	664	N/A	INTRINSIC
low complexity region	685	719	N/A	INTRINSIC
low complexity region	766	782	N/A	INTRINSIC
DZF	784	1038	5.42e-170	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128475

SMART Domains

Protein: ENSMUSP00000117207
Gene: ENSMUSG00000022201

Domain	Start	End	E-Value	Type
low complexity region	32	79	N/A	INTRINSIC
low complexity region	122	145	N/A	INTRINSIC
low complexity region	159	187	N/A	INTRINSIC
low complexity region	192	247	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228196

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein characterized by its DZF (domain associated with zinc fingers) domain. The encoded protein may play a role in the nucleocytoplasmic shuttling of another RNA-binding protein, Staufen homolog 2, in neurons. Expression of this gene is regulated through alternative polyadenylation that mediates differential microRNA targeting. Elevated expression of this gene has been observed in human patients with pancreatic cancer and knockdown of this gene may result in reduced viability and invasion of pancreatic cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired gastrulation, with increased apoptosis and a low mitotic index, and die between embryonic days 8 and 9. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,065,401	R117L	probably benign	Het
4930447C04Rik	G	A	12: 72,881,346	A537V	possibly damaging	Het
4930579F01Rik	A	C	3: 138,183,756	D33E	probably damaging	Het
9530053A07Rik	A	T	7: 28,155,492	I1848F	probably damaging	Het
Acnat1	T	C	4: 49,447,835	K249E	possibly damaging	Het
Ankrd13a	T	C	5: 114,804,234	I526T	possibly damaging	Het
Aplp1	C	A	7: 30,436,027	E535D	probably benign	Het
Armc8	T	A	9: 99,505,290	H425L	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asprv1	C	T	6: 86,628,636	Q155*	probably null	Het
Atl1	A	G	12: 69,926,188	Q94R	probably benign	Het
Atp2a2	A	G	5: 122,457,377	L970P	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Bod1l	A	G	5: 41,816,429	M2514T	probably benign	Het
Cacfd1	T	A	2: 27,018,939	D97E	probably benign	Het
Cacna1e	A	G	1: 154,561,758	L344P	probably damaging	Het
Cacna2d2	C	A	9: 107,517,416	R596S	probably damaging	Het
Catip	C	A	1: 74,364,652	S176*	probably null	Het
Cdcp1	G	A	9: 123,173,588	S806L	probably damaging	Het
Cdk6	A	T	5: 3,520,675	I289L	probably benign	Het
Cers3	C	T	7: 66,781,823	T182I	probably damaging	Het
Cfap46	T	A	7: 139,683,008	N43I	probably null	Het
Clec4n	A	T	6: 123,230,033	R5S	possibly damaging	Het
Cnr2	G	T	4: 135,916,701	S30I	probably benign	Het
Col18a1	C	T	10: 77,071,336	G870E	probably damaging	Het
Cpne6	T	C	14: 55,515,220	V289A	possibly damaging	Het
Crym	G	A	7: 120,197,715	L141F	probably benign	Het
Cxxc5	T	C	18: 35,858,569	S8P	unknown	Het
Dido1	A	C	2: 180,684,970	S453R	possibly damaging	Het
Dnah2	A	C	11: 69,477,202	S1770R	probably benign	Het
Dnah7a	A	G	1: 53,495,989	V2704A	possibly damaging	Het
Eml5	T	C	12: 98,794,276	N1738S	probably damaging	Het
Eri3	A	G	4: 117,582,639	T138A	possibly damaging	Het
Ext2	C	T	2: 93,707,287	E585K	probably damaging	Het
Fam35a	C	G	14: 34,268,876	Q24H	probably damaging	Het
Fam84b	A	G	15: 60,823,649	C83R	probably damaging	Het
Fbxw19	T	A	9: 109,494,988	S38C	probably damaging	Het
Fmo6	G	A	1: 162,926,106	P156S	probably damaging	Het
Frem3	T	C	8: 80,612,710	L544P	probably damaging	Het
Frem3	A	T	8: 80,613,135	I686F	probably benign	Het
Gabra1	T	C	11: 42,140,350	Y251C	probably benign	Het
Gemin4	G	T	11: 76,211,161	Q925K	probably benign	Het
Gm18856	T	A	13: 13,964,689		probably benign	Het
Gnb1	A	T	4: 155,551,714	T164S	probably benign	Het
Gpx6	A	G	13: 21,313,652	D31G	possibly damaging	Het
Gzmd	A	C	14: 56,130,345	I157S	probably benign	Het
Il31ra	T	A	13: 112,547,466	N43I	possibly damaging	Het
Irak3	T	C	10: 120,165,130	T297A	probably benign	Het
Kank2	T	C	9: 21,774,631	D649G	probably damaging	Het
Kif3b	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	2: 153,317,462		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	G	9: 110,446,747	F111S	probably damaging	Het
Lrp5	A	G	19: 3,647,585	S319P	possibly damaging	Het
Marc1	T	C	1: 184,802,002	E223G	probably damaging	Het
Mettl15	T	C	2: 109,131,665		probably null	Het
Ncoa1	T	C	12: 4,270,748	Q1107R	possibly damaging	Het
Ncoa7	T	G	10: 30,694,211	M251L	probably damaging	Het
Nos2	A	T	11: 78,956,570	M1023L	probably benign	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Olfr1491	A	T	19: 13,705,496	Y223F	probably damaging	Het
Olfr177	T	A	16: 58,872,898	N84I	probably damaging	Het
Olfr482	T	A	7: 108,095,286	I95F	probably damaging	Het
Olfr591	A	G	7: 103,172,986	I217T	probably damaging	Het
Olfr711	A	T	7: 106,971,983	Y120*	probably null	Het
Olfr776	T	C	10: 129,261,213	I84T	probably damaging	Het
Parm1	G	A	5: 91,594,447	E225K	possibly damaging	Het
Pdzd2	A	C	15: 12,372,961	S2363A	probably damaging	Het
Piezo1	A	G	8: 122,491,403	L1199P	probably damaging	Het
Prpsap1	A	T	11: 116,479,708	M141K	probably benign	Het
Prss29	A	T	17: 25,320,283	M1L	possibly damaging	Het
Pter	T	A	2: 12,978,606	S141T	probably benign	Het
Ptpru	A	T	4: 131,774,351	D1181E	probably damaging	Het
Rab3ip	T	A	10: 116,939,254	Q66H	probably damaging	Het
Rgs12	A	T	5: 35,021,167	T779S	probably damaging	Het
Rgs22	A	G	15: 36,048,776	F786S	probably damaging	Het
Rnasel	A	T	1: 153,760,794	D640V	possibly damaging	Het
Rp1	T	C	1: 4,345,676	T1738A	probably damaging	Het
Sacs	T	C	14: 61,210,059	S3185P	probably damaging	Het
Scnn1a	T	A	6: 125,338,893	D321E	possibly damaging	Het
Sec31b	G	C	19: 44,518,586	L1014V	probably benign	Het
Serpinb10	A	G	1: 107,540,960	Y111C	probably damaging	Het
Siglecg	A	G	7: 43,417,889	K627E	possibly damaging	Het
Sigmar1	T	C	4: 41,740,845	I95V	probably benign	Het
Sirpb1b	T	A	3: 15,548,759	T88S	possibly damaging	Het
Spire2	T	G	8: 123,358,156	L245R	probably damaging	Het
Stard9	C	A	2: 120,696,711	P1150T	probably benign	Het
Stat6	C	A	10: 127,653,256	T380N	probably damaging	Het
Sult3a1	G	A	10: 33,870,170	G162E	probably benign	Het
Surf4	T	C	2: 26,933,698		probably null	Het
Tacc2	T	C	7: 130,625,419	M1278T	probably benign	Het
Tacr2	T	A	10: 62,261,327		probably null	Het
Tcaf1	A	T	6: 42,678,989	V351E	probably damaging	Het
Tmcc2	A	G	1: 132,380,980	S59P	probably damaging	Het
Tmem17	G	A	11: 22,517,266	S60N	possibly damaging	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tmprss7	A	T	16: 45,679,390	I307N	probably benign	Het
Treml2	A	T	17: 48,302,758	T73S	possibly damaging	Het
Trrap	A	G	5: 144,837,202	H2876R	possibly damaging	Het
Tyw3	A	G	3: 154,596,869	I53T	probably damaging	Het
Ugp2	A	G	11: 21,333,791	I92T	possibly damaging	Het
Vmn2r66	A	T	7: 84,994,958	M748K	possibly damaging	Het
Vmn2r82	T	C	10: 79,356,744	S52P	possibly damaging	Het
Wdr37	A	T	13: 8,836,792	S320T	probably benign	Het
Zbtb16	A	T	9: 48,832,283	M243K	probably benign	Het

Other mutations in Zfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Zfr	APN	15	12159646	missense	probably benign	0.26
IGL01759:Zfr	APN	15	12159655	missense	probably damaging	0.99
IGL01935:Zfr	APN	15	12180712	missense	probably benign	0.42
IGL02056:Zfr	APN	15	12154447	missense	probably damaging	1.00
IGL03009:Zfr	APN	15	12162235	missense	probably damaging	1.00
IGL03147:Zfr	UTSW	15	12140552	nonsense	probably null
PIT4504001:Zfr	UTSW	15	12166158	missense	possibly damaging	0.48
R0377:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R0678:Zfr	UTSW	15	12184085	missense	probably damaging	1.00
R0783:Zfr	UTSW	15	12162182	missense	probably damaging	1.00
R0787:Zfr	UTSW	15	12140548	missense	unknown
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1464:Zfr	UTSW	15	12146372	missense	probably damaging	1.00
R1558:Zfr	UTSW	15	12140644	missense	unknown
R1619:Zfr	UTSW	15	12150387	missense	possibly damaging	0.52
R1924:Zfr	UTSW	15	12160629	missense	possibly damaging	0.74
R2163:Zfr	UTSW	15	12162223	missense	probably damaging	1.00
R2958:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2960:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2961:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2962:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R2963:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R3012:Zfr	UTSW	15	12166163	missense	probably damaging	1.00
R3054:Zfr	UTSW	15	12154507	missense	probably damaging	1.00
R3429:Zfr	UTSW	15	12152920	missense	probably benign	0.00
R3611:Zfr	UTSW	15	12159762	critical splice donor site	probably null
R3825:Zfr	UTSW	15	12166191	missense	probably damaging	1.00
R3882:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4080:Zfr	UTSW	15	12162233	missense	probably benign	0.08
R4241:Zfr	UTSW	15	12149659	missense	probably damaging	1.00
R4366:Zfr	UTSW	15	12156330	missense	probably damaging	0.99
R4375:Zfr	UTSW	15	12118340	critical splice donor site	probably null
R4893:Zfr	UTSW	15	12136542	missense	unknown
R4899:Zfr	UTSW	15	12166145	missense	probably benign	0.11
R4915:Zfr	UTSW	15	12162112	critical splice acceptor site	probably null
R5870:Zfr	UTSW	15	12160615	missense	probably damaging	1.00
R6162:Zfr	UTSW	15	12146245	missense	unknown
R6163:Zfr	UTSW	15	12146245	missense	unknown
R6165:Zfr	UTSW	15	12146245	missense	unknown
R6187:Zfr	UTSW	15	12146231	small deletion	probably benign
R6251:Zfr	UTSW	15	12160591	missense	probably benign	0.02
R6903:Zfr	UTSW	15	12136455	missense	unknown
R6959:Zfr	UTSW	15	12150323	missense	probably damaging	1.00
R7133:Zfr	UTSW	15	12180638	missense	probably damaging	1.00
R7167:Zfr	UTSW	15	12180929	missense	probably benign	0.01
R7212:Zfr	UTSW	15	12146223	nonsense	probably null
R7373:Zfr	UTSW	15	12140559	missense	unknown
R7489:Zfr	UTSW	15	12152982	missense	probably benign	0.24
R7602:Zfr	UTSW	15	12159677	missense	possibly damaging	0.56
R7623:Zfr	UTSW	15	12160528	missense	possibly damaging	0.83
R7896:Zfr	UTSW	15	12146377	missense	probably damaging	1.00
R8188:Zfr	UTSW	15	12171818	missense	probably damaging	1.00
R8289:Zfr	UTSW	15	12135271	missense	noncoding transcript
R8382:Zfr	UTSW	15	12152968	nonsense	probably null
R8475:Zfr	UTSW	15	12150369	missense	probably benign	0.08
R9124:Zfr	UTSW	15	12136671	missense	unknown
R9493:Zfr	UTSW	15	12180620	critical splice acceptor site	probably null
R9598:Zfr	UTSW	15	12162206	missense	probably damaging	0.99
R9631:Zfr	UTSW	15	12154542	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGGGGTTTGAAAACACTTGACTTCC -3'
(R):5'- GCCATATTGGTAGGTATCGCTGACAC -3'

Sequencing Primer
(F):5'- CACTAGCGACCTTTAAGTTGAG -3'
(R):5'- GGTAGGTATCGCTGACACTTTAG -3'

Posted On

2014-04-13