Mutagenetix > Incidental Mutation

Incidental Mutation 'R1538:Rgs22'

169742

Institutional Source

Beutler Lab

Gene Symbol

Rgs22

Ensembl Gene

ENSMUSG00000037627

Gene Name

regulator of G-protein signalling 22

Synonyms

MMRRC Submission

039577-MU

Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1538 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36009479-36140400 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36048776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 786 (F786S)

Ref Sequence

ENSEMBL: ENSMUSP00000134185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172831] [ENSMUST00000174881]

AlphaFold

G3UYX5

Predicted Effect

probably benign
Transcript: ENSMUST00000172737

SMART Domains

Protein: ENSMUSP00000133508
Gene: ENSMUSG00000037627

Domain	Start	End	E-Value	Type
Blast:RGS	231	262	1e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000172831
AA Change: F910S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: F910S

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
low complexity region	62	76	N/A	INTRINSIC
low complexity region	173	179	N/A	INTRINSIC
low complexity region	376	391	N/A	INTRINSIC
RGS	845	973	3.15e-2	SMART
RGS	1014	1134	1.56e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174881
AA Change: F786S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134185
Gene: ENSMUSG00000037627
AA Change: F786S

Domain	Start	End	E-Value	Type
low complexity region	23	37	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
RGS	721	849	3.15e-2	SMART
RGS	890	1010	1.56e-15	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.6%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	G	T	3: 138,065,401	R117L	probably benign	Het
4930447C04Rik	G	A	12: 72,881,346	A537V	possibly damaging	Het
4930579F01Rik	A	C	3: 138,183,756	D33E	probably damaging	Het
9530053A07Rik	A	T	7: 28,155,492	I1848F	probably damaging	Het
Acnat1	T	C	4: 49,447,835	K249E	possibly damaging	Het
Ankrd13a	T	C	5: 114,804,234	I526T	possibly damaging	Het
Aplp1	C	A	7: 30,436,027	E535D	probably benign	Het
Armc8	T	A	9: 99,505,290	H425L	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Asprv1	C	T	6: 86,628,636	Q155*	probably null	Het
Atl1	A	G	12: 69,926,188	Q94R	probably benign	Het
Atp2a2	A	G	5: 122,457,377	L970P	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Bod1l	A	G	5: 41,816,429	M2514T	probably benign	Het
Cacfd1	T	A	2: 27,018,939	D97E	probably benign	Het
Cacna1e	A	G	1: 154,561,758	L344P	probably damaging	Het
Cacna2d2	C	A	9: 107,517,416	R596S	probably damaging	Het
Catip	C	A	1: 74,364,652	S176*	probably null	Het
Cdcp1	G	A	9: 123,173,588	S806L	probably damaging	Het
Cdk6	A	T	5: 3,520,675	I289L	probably benign	Het
Cers3	C	T	7: 66,781,823	T182I	probably damaging	Het
Cfap46	T	A	7: 139,683,008	N43I	probably null	Het
Clec4n	A	T	6: 123,230,033	R5S	possibly damaging	Het
Cnr2	G	T	4: 135,916,701	S30I	probably benign	Het
Col18a1	C	T	10: 77,071,336	G870E	probably damaging	Het
Cpne6	T	C	14: 55,515,220	V289A	possibly damaging	Het
Crym	G	A	7: 120,197,715	L141F	probably benign	Het
Cxxc5	T	C	18: 35,858,569	S8P	unknown	Het
Dido1	A	C	2: 180,684,970	S453R	possibly damaging	Het
Dnah2	A	C	11: 69,477,202	S1770R	probably benign	Het
Dnah7a	A	G	1: 53,495,989	V2704A	possibly damaging	Het
Eml5	T	C	12: 98,794,276	N1738S	probably damaging	Het
Eri3	A	G	4: 117,582,639	T138A	possibly damaging	Het
Ext2	C	T	2: 93,707,287	E585K	probably damaging	Het
Fam35a	C	G	14: 34,268,876	Q24H	probably damaging	Het
Fam84b	A	G	15: 60,823,649	C83R	probably damaging	Het
Fbxw19	T	A	9: 109,494,988	S38C	probably damaging	Het
Fmo6	G	A	1: 162,926,106	P156S	probably damaging	Het
Frem3	T	C	8: 80,612,710	L544P	probably damaging	Het
Frem3	A	T	8: 80,613,135	I686F	probably benign	Het
Gabra1	T	C	11: 42,140,350	Y251C	probably benign	Het
Gemin4	G	T	11: 76,211,161	Q925K	probably benign	Het
Gm18856	T	A	13: 13,964,689		probably benign	Het
Gnb1	A	T	4: 155,551,714	T164S	probably benign	Het
Gpx6	A	G	13: 21,313,652	D31G	possibly damaging	Het
Gzmd	A	C	14: 56,130,345	I157S	probably benign	Het
Il31ra	T	A	13: 112,547,466	N43I	possibly damaging	Het
Irak3	T	C	10: 120,165,130	T297A	probably benign	Het
Kank2	T	C	9: 21,774,631	D649G	probably damaging	Het
Kif3b	AGAGGAGGAGGAGGAGG	AGAGGAGGAGGAGG	2: 153,317,462		probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klhl18	A	G	9: 110,446,747	F111S	probably damaging	Het
Lrp5	A	G	19: 3,647,585	S319P	possibly damaging	Het
Marc1	T	C	1: 184,802,002	E223G	probably damaging	Het
Mettl15	T	C	2: 109,131,665		probably null	Het
Ncoa1	T	C	12: 4,270,748	Q1107R	possibly damaging	Het
Ncoa7	T	G	10: 30,694,211	M251L	probably damaging	Het
Nos2	A	T	11: 78,956,570	M1023L	probably benign	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Olfr1491	A	T	19: 13,705,496	Y223F	probably damaging	Het
Olfr177	T	A	16: 58,872,898	N84I	probably damaging	Het
Olfr482	T	A	7: 108,095,286	I95F	probably damaging	Het
Olfr591	A	G	7: 103,172,986	I217T	probably damaging	Het
Olfr711	A	T	7: 106,971,983	Y120*	probably null	Het
Olfr776	T	C	10: 129,261,213	I84T	probably damaging	Het
Parm1	G	A	5: 91,594,447	E225K	possibly damaging	Het
Pdzd2	A	C	15: 12,372,961	S2363A	probably damaging	Het
Piezo1	A	G	8: 122,491,403	L1199P	probably damaging	Het
Prpsap1	A	T	11: 116,479,708	M141K	probably benign	Het
Prss29	A	T	17: 25,320,283	M1L	possibly damaging	Het
Pter	T	A	2: 12,978,606	S141T	probably benign	Het
Ptpru	A	T	4: 131,774,351	D1181E	probably damaging	Het
Rab3ip	T	A	10: 116,939,254	Q66H	probably damaging	Het
Rgs12	A	T	5: 35,021,167	T779S	probably damaging	Het
Rnasel	A	T	1: 153,760,794	D640V	possibly damaging	Het
Rp1	T	C	1: 4,345,676	T1738A	probably damaging	Het
Sacs	T	C	14: 61,210,059	S3185P	probably damaging	Het
Scnn1a	T	A	6: 125,338,893	D321E	possibly damaging	Het
Sec31b	G	C	19: 44,518,586	L1014V	probably benign	Het
Serpinb10	A	G	1: 107,540,960	Y111C	probably damaging	Het
Siglecg	A	G	7: 43,417,889	K627E	possibly damaging	Het
Sigmar1	T	C	4: 41,740,845	I95V	probably benign	Het
Sirpb1b	T	A	3: 15,548,759	T88S	possibly damaging	Het
Spire2	T	G	8: 123,358,156	L245R	probably damaging	Het
Stard9	C	A	2: 120,696,711	P1150T	probably benign	Het
Stat6	C	A	10: 127,653,256	T380N	probably damaging	Het
Sult3a1	G	A	10: 33,870,170	G162E	probably benign	Het
Surf4	T	C	2: 26,933,698		probably null	Het
Tacc2	T	C	7: 130,625,419	M1278T	probably benign	Het
Tacr2	T	A	10: 62,261,327		probably null	Het
Tcaf1	A	T	6: 42,678,989	V351E	probably damaging	Het
Tmcc2	A	G	1: 132,380,980	S59P	probably damaging	Het
Tmem17	G	A	11: 22,517,266	S60N	possibly damaging	Het
Tmem63b	C	G	17: 45,678,978	R88P	possibly damaging	Het
Tmprss7	A	T	16: 45,679,390	I307N	probably benign	Het
Treml2	A	T	17: 48,302,758	T73S	possibly damaging	Het
Trrap	A	G	5: 144,837,202	H2876R	possibly damaging	Het
Tyw3	A	G	3: 154,596,869	I53T	probably damaging	Het
Ugp2	A	G	11: 21,333,791	I92T	possibly damaging	Het
Vmn2r66	A	T	7: 84,994,958	M748K	possibly damaging	Het
Vmn2r82	T	C	10: 79,356,744	S52P	possibly damaging	Het
Wdr37	A	T	13: 8,836,792	S320T	probably benign	Het
Zbtb16	A	T	9: 48,832,283	M243K	probably benign	Het
Zfr	C	T	15: 12,150,243	T432I	possibly damaging	Het

Other mutations in Rgs22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Rgs22	APN	15	36099931	missense	possibly damaging	0.93
IGL00594:Rgs22	APN	15	36083631	missense	probably benign	0.00
IGL01464:Rgs22	APN	15	36083641	missense	possibly damaging	0.90
IGL01686:Rgs22	APN	15	36103835	missense	probably benign	0.00
IGL01761:Rgs22	APN	15	36103751	missense	probably damaging	0.99
IGL02045:Rgs22	APN	15	36013154	missense	probably benign	0.33
IGL02378:Rgs22	APN	15	36103805	missense	probably benign	0.00
IGL02490:Rgs22	APN	15	36054847	missense	probably damaging	1.00
IGL03219:Rgs22	APN	15	36107048	missense	probably damaging	1.00
IGL03229:Rgs22	APN	15	36015779	splice site	probably benign
IGL03328:Rgs22	APN	15	36043204	critical splice donor site	probably null
3-1:Rgs22	UTSW	15	36100036	missense	possibly damaging	0.48
R0254:Rgs22	UTSW	15	36104552	missense	probably damaging	0.99
R0463:Rgs22	UTSW	15	36092938	missense	probably damaging	1.00
R0467:Rgs22	UTSW	15	36099795	nonsense	probably null
R0486:Rgs22	UTSW	15	36092882	missense	probably damaging	0.98
R0554:Rgs22	UTSW	15	36054709	missense	probably benign	0.10
R0602:Rgs22	UTSW	15	36139872	splice site	probably benign
R0906:Rgs22	UTSW	15	36103902	intron	probably benign
R1159:Rgs22	UTSW	15	36040693	missense	probably damaging	1.00
R1300:Rgs22	UTSW	15	36101762	missense	probably benign	0.43
R1439:Rgs22	UTSW	15	36025793	splice site	probably benign
R1491:Rgs22	UTSW	15	36092901	missense	probably damaging	0.98
R1502:Rgs22	UTSW	15	36080851	missense	probably damaging	1.00
R1514:Rgs22	UTSW	15	36013100	missense	probably benign	0.00
R1784:Rgs22	UTSW	15	36087436	missense	probably damaging	1.00
R1938:Rgs22	UTSW	15	36101804	missense	probably benign	0.00
R1972:Rgs22	UTSW	15	36103836	missense	probably benign	0.01
R2109:Rgs22	UTSW	15	36099734	nonsense	probably null
R2208:Rgs22	UTSW	15	36050232	missense	probably benign	0.01
R3696:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3697:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3698:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3879:Rgs22	UTSW	15	36106905	missense	possibly damaging	0.52
R4080:Rgs22	UTSW	15	36107076	missense	probably damaging	1.00
R4363:Rgs22	UTSW	15	36103874	missense	probably damaging	0.99
R4591:Rgs22	UTSW	15	36100136	missense	probably benign	0.01
R4673:Rgs22	UTSW	15	36099933	missense	probably benign	0.04
R4829:Rgs22	UTSW	15	36103888	missense	probably damaging	1.00
R4831:Rgs22	UTSW	15	36050148	missense	probably benign	0.00
R4865:Rgs22	UTSW	15	36100212	missense	probably damaging	1.00
R4907:Rgs22	UTSW	15	36087424	missense	possibly damaging	0.61
R4944:Rgs22	UTSW	15	36025942	missense	possibly damaging	0.83
R4975:Rgs22	UTSW	15	36054876	nonsense	probably null
R5056:Rgs22	UTSW	15	36050245	splice site	probably null
R5126:Rgs22	UTSW	15	36040644	missense	probably damaging	0.96
R5138:Rgs22	UTSW	15	36099788	missense	probably benign	0.04
R5444:Rgs22	UTSW	15	36015627	missense	possibly damaging	0.83
R5507:Rgs22	UTSW	15	36099652	missense	probably damaging	0.99
R5640:Rgs22	UTSW	15	36106955	missense	probably benign	0.00
R5969:Rgs22	UTSW	15	36015636	missense	probably benign	0.00
R6005:Rgs22	UTSW	15	36010567	missense	probably benign	0.39
R6053:Rgs22	UTSW	15	36100007	missense	probably benign	0.04
R6134:Rgs22	UTSW	15	36107048	missense	probably damaging	1.00
R6230:Rgs22	UTSW	15	36100030	missense	probably benign	0.02
R6295:Rgs22	UTSW	15	36087374	missense	probably benign	0.00
R6352:Rgs22	UTSW	15	36092921	missense	probably damaging	1.00
R6809:Rgs22	UTSW	15	36048764	missense	probably damaging	1.00
R6900:Rgs22	UTSW	15	36010747	missense	possibly damaging	0.61
R6947:Rgs22	UTSW	15	36103890	critical splice acceptor site	probably null
R7102:Rgs22	UTSW	15	36122313	missense	probably damaging	1.00
R7126:Rgs22	UTSW	15	36103808	missense	probably damaging	0.97
R7263:Rgs22	UTSW	15	36015643	missense	possibly damaging	0.86
R7623:Rgs22	UTSW	15	36040710	missense	probably benign	0.08
R7732:Rgs22	UTSW	15	36025981	missense	probably damaging	1.00
R7748:Rgs22	UTSW	15	36122269	critical splice donor site	probably null
R7771:Rgs22	UTSW	15	36050078	missense	possibly damaging	0.94
R7835:Rgs22	UTSW	15	36081911	critical splice donor site	probably null
R7849:Rgs22	UTSW	15	36099712	missense	probably damaging	1.00
R7954:Rgs22	UTSW	15	36082002	missense	possibly damaging	0.75
R8384:Rgs22	UTSW	15	36046012	critical splice donor site	probably null
R8516:Rgs22	UTSW	15	36010335	makesense	probably null
R8904:Rgs22	UTSW	15	36025981	missense	probably damaging	1.00
R8923:Rgs22	UTSW	15	36092960	missense	probably damaging	1.00
R9287:Rgs22	UTSW	15	36098263	missense	probably damaging	1.00
R9324:Rgs22	UTSW	15	36087398	missense	probably benign
R9660:Rgs22	UTSW	15	36040710	missense	probably benign	0.08
R9679:Rgs22	UTSW	15	36087441	missense	probably benign	0.00
R9728:Rgs22	UTSW	15	36040710	missense	probably benign	0.08
RF035:Rgs22	UTSW	15	36010835	critical splice acceptor site	probably benign
RF043:Rgs22	UTSW	15	36010836	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCCAGATGAGTGCCACTTTAGCC -3'
(R):5'- CCAGGACTGAGAATGTAGCAACAGC -3'

Sequencing Primer
(F):5'- GAGTGCCACTTTAGCCAATAAAGC -3'
(R):5'- ATCAGTCGCCTCCTGAGTG -3'

Posted On

2014-04-13