Incidental Mutation 'R1538:Or5k14'
ID 169745
Institutional Source Beutler Lab
Gene Symbol Or5k14
Ensembl Gene ENSMUSG00000063137
Gene Name olfactory receptor family 5 subfamily K member 14
Synonyms Olfr176, GA_x54KRFPKG5P-55091371-55090442, MOR184-8, GA_x54KRFPKG5P-55043245-55042289, Olfr177, MOR184-7
MMRRC Submission 039577-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R1538 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 58689766-58693511 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58693261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 84 (N84I)
Ref Sequence ENSEMBL: ENSMUSP00000150269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072853] [ENSMUST00000217377]
AlphaFold E9Q7W1
Predicted Effect probably damaging
Transcript: ENSMUST00000072853
AA Change: N84I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072631
Gene: ENSMUSG00000063137
AA Change: N84I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.7e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 254 8.3e-6 PFAM
Pfam:7tm_1 41 290 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205920
AA Change: N84I
Predicted Effect probably damaging
Transcript: ENSMUST00000217377
AA Change: N84I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 137,771,162 (GRCm39) R117L probably benign Het
4930447C04Rik G A 12: 72,928,120 (GRCm39) A537V possibly damaging Het
4930579F01Rik A C 3: 137,889,517 (GRCm39) D33E probably damaging Het
Acnat1 T C 4: 49,447,835 (GRCm39) K249E possibly damaging Het
Ankrd13a T C 5: 114,942,295 (GRCm39) I526T possibly damaging Het
Aplp1 C A 7: 30,135,452 (GRCm39) E535D probably benign Het
Armc8 T A 9: 99,387,343 (GRCm39) H425L probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Asprv1 C T 6: 86,605,618 (GRCm39) Q155* probably null Het
Atl1 A G 12: 69,972,962 (GRCm39) Q94R probably benign Het
Atp2a2 A G 5: 122,595,440 (GRCm39) L970P probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
Bod1l A G 5: 41,973,772 (GRCm39) M2514T probably benign Het
Cacfd1 T A 2: 26,908,951 (GRCm39) D97E probably benign Het
Cacna1e A G 1: 154,437,504 (GRCm39) L344P probably damaging Het
Cacna2d2 C A 9: 107,394,615 (GRCm39) R596S probably damaging Het
Catip C A 1: 74,403,811 (GRCm39) S176* probably null Het
Cdcp1 G A 9: 123,002,653 (GRCm39) S806L probably damaging Het
Cdk6 A T 5: 3,570,675 (GRCm39) I289L probably benign Het
Cers3 C T 7: 66,431,571 (GRCm39) T182I probably damaging Het
Cfap46 T A 7: 139,262,924 (GRCm39) N43I probably null Het
Clec4n A T 6: 123,206,992 (GRCm39) R5S possibly damaging Het
Cnr2 G T 4: 135,644,012 (GRCm39) S30I probably benign Het
Col18a1 C T 10: 76,907,170 (GRCm39) G870E probably damaging Het
Cpne6 T C 14: 55,752,677 (GRCm39) V289A possibly damaging Het
Crym G A 7: 119,796,938 (GRCm39) L141F probably benign Het
Cxxc5 T C 18: 35,991,622 (GRCm39) S8P unknown Het
Dido1 A C 2: 180,326,763 (GRCm39) S453R possibly damaging Het
Dnah2 A C 11: 69,368,028 (GRCm39) S1770R probably benign Het
Dnah7a A G 1: 53,535,148 (GRCm39) V2704A possibly damaging Het
Eml5 T C 12: 98,760,535 (GRCm39) N1738S probably damaging Het
Eri3 A G 4: 117,439,836 (GRCm39) T138A possibly damaging Het
Ext2 C T 2: 93,537,632 (GRCm39) E585K probably damaging Het
Fbxw19 T A 9: 109,324,056 (GRCm39) S38C probably damaging Het
Fcgbpl1 A T 7: 27,854,917 (GRCm39) I1848F probably damaging Het
Fmo6 G A 1: 162,753,675 (GRCm39) P156S probably damaging Het
Frem3 A T 8: 81,339,764 (GRCm39) I686F probably benign Het
Frem3 T C 8: 81,339,339 (GRCm39) L544P probably damaging Het
Gabra1 T C 11: 42,031,177 (GRCm39) Y251C probably benign Het
Gemin4 G T 11: 76,101,987 (GRCm39) Q925K probably benign Het
Gm18856 T A 13: 14,139,274 (GRCm39) probably benign Het
Gnb1 A T 4: 155,636,171 (GRCm39) T164S probably benign Het
Gpx6 A G 13: 21,497,822 (GRCm39) D31G possibly damaging Het
Gzmd A C 14: 56,367,802 (GRCm39) I157S probably benign Het
Il31ra T A 13: 112,684,000 (GRCm39) N43I possibly damaging Het
Irak3 T C 10: 120,001,035 (GRCm39) T297A probably benign Het
Kank2 T C 9: 21,685,927 (GRCm39) D649G probably damaging Het
Kif3b AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 2: 153,159,382 (GRCm39) probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Klhl18 A G 9: 110,275,815 (GRCm39) F111S probably damaging Het
Lratd2 A G 15: 60,695,498 (GRCm39) C83R probably damaging Het
Lrp5 A G 19: 3,697,585 (GRCm39) S319P possibly damaging Het
Mettl15 T C 2: 108,962,010 (GRCm39) probably null Het
Mtarc1 T C 1: 184,534,199 (GRCm39) E223G probably damaging Het
Ncoa1 T C 12: 4,320,748 (GRCm39) Q1107R possibly damaging Het
Ncoa7 T G 10: 30,570,207 (GRCm39) M251L probably damaging Het
Nos2 A T 11: 78,847,396 (GRCm39) M1023L probably benign Het
Nup107 T C 10: 117,626,399 (GRCm39) K25E probably damaging Het
Or10q1b A T 19: 13,682,860 (GRCm39) Y223F probably damaging Het
Or52s1b A G 7: 102,822,193 (GRCm39) I217T probably damaging Het
Or5p58 T A 7: 107,694,493 (GRCm39) I95F probably damaging Het
Or6b6 A T 7: 106,571,190 (GRCm39) Y120* probably null Het
Or6c206 T C 10: 129,097,082 (GRCm39) I84T probably damaging Het
Parm1 G A 5: 91,742,306 (GRCm39) E225K possibly damaging Het
Pdzd2 A C 15: 12,373,047 (GRCm39) S2363A probably damaging Het
Piezo1 A G 8: 123,218,142 (GRCm39) L1199P probably damaging Het
Prpsap1 A T 11: 116,370,534 (GRCm39) M141K probably benign Het
Prss29 A T 17: 25,539,257 (GRCm39) M1L possibly damaging Het
Pter T A 2: 12,983,417 (GRCm39) S141T probably benign Het
Ptpru A T 4: 131,501,662 (GRCm39) D1181E probably damaging Het
Rab3ip T A 10: 116,775,159 (GRCm39) Q66H probably damaging Het
Rgs12 A T 5: 35,178,511 (GRCm39) T779S probably damaging Het
Rgs22 A G 15: 36,048,922 (GRCm39) F786S probably damaging Het
Rnasel A T 1: 153,636,540 (GRCm39) D640V possibly damaging Het
Rp1 T C 1: 4,415,899 (GRCm39) T1738A probably damaging Het
Sacs T C 14: 61,447,508 (GRCm39) S3185P probably damaging Het
Scnn1a T A 6: 125,315,856 (GRCm39) D321E possibly damaging Het
Sec31b G C 19: 44,507,025 (GRCm39) L1014V probably benign Het
Serpinb10 A G 1: 107,468,690 (GRCm39) Y111C probably damaging Het
Shld2 C G 14: 33,990,833 (GRCm39) Q24H probably damaging Het
Siglecg A G 7: 43,067,313 (GRCm39) K627E possibly damaging Het
Sigmar1 T C 4: 41,740,845 (GRCm39) I95V probably benign Het
Sirpb1b T A 3: 15,613,819 (GRCm39) T88S possibly damaging Het
Spire2 T G 8: 124,084,895 (GRCm39) L245R probably damaging Het
Stard9 C A 2: 120,527,192 (GRCm39) P1150T probably benign Het
Stat6 C A 10: 127,489,125 (GRCm39) T380N probably damaging Het
Sult3a1 G A 10: 33,746,166 (GRCm39) G162E probably benign Het
Surf4 T C 2: 26,823,710 (GRCm39) probably null Het
Tacc2 T C 7: 130,227,149 (GRCm39) M1278T probably benign Het
Tacr2 T A 10: 62,097,106 (GRCm39) probably null Het
Tcaf1 A T 6: 42,655,923 (GRCm39) V351E probably damaging Het
Tmcc2 A G 1: 132,308,718 (GRCm39) S59P probably damaging Het
Tmem17 G A 11: 22,467,266 (GRCm39) S60N possibly damaging Het
Tmem63b C G 17: 45,989,904 (GRCm39) R88P possibly damaging Het
Tmprss7 A T 16: 45,499,753 (GRCm39) I307N probably benign Het
Treml2 A T 17: 48,609,786 (GRCm39) T73S possibly damaging Het
Trrap A G 5: 144,774,012 (GRCm39) H2876R possibly damaging Het
Tyw3 A G 3: 154,302,506 (GRCm39) I53T probably damaging Het
Ugp2 A G 11: 21,283,791 (GRCm39) I92T possibly damaging Het
Vmn2r66 A T 7: 84,644,166 (GRCm39) M748K possibly damaging Het
Vmn2r82 T C 10: 79,192,578 (GRCm39) S52P possibly damaging Het
Wdr37 A T 13: 8,886,828 (GRCm39) S320T probably benign Het
Zbtb16 A T 9: 48,743,583 (GRCm39) M243K probably benign Het
Zfr C T 15: 12,150,329 (GRCm39) T432I possibly damaging Het
Other mutations in Or5k14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Or5k14 APN 16 58,693,399 (GRCm39) missense probably damaging 1.00
IGL02223:Or5k14 APN 16 58,693,057 (GRCm39) missense probably damaging 1.00
R0131:Or5k14 UTSW 16 58,693,269 (GRCm39) missense probably benign 0.01
R0131:Or5k14 UTSW 16 58,693,269 (GRCm39) missense probably benign 0.01
R0132:Or5k14 UTSW 16 58,693,269 (GRCm39) missense probably benign 0.01
R0245:Or5k14 UTSW 16 58,693,229 (GRCm39) missense probably benign 0.01
R0717:Or5k14 UTSW 16 58,693,133 (GRCm39) missense probably damaging 1.00
R0975:Or5k14 UTSW 16 58,693,513 (GRCm39) splice site probably null
R1037:Or5k14 UTSW 16 58,693,333 (GRCm39) missense probably damaging 1.00
R1256:Or5k14 UTSW 16 58,693,206 (GRCm39) nonsense probably null
R1278:Or5k14 UTSW 16 58,693,340 (GRCm39) missense probably damaging 1.00
R1992:Or5k14 UTSW 16 58,692,874 (GRCm39) missense probably benign 0.43
R2173:Or5k14 UTSW 16 58,692,982 (GRCm39) missense probably damaging 0.99
R2392:Or5k14 UTSW 16 58,692,797 (GRCm39) missense probably damaging 1.00
R5651:Or5k14 UTSW 16 58,692,847 (GRCm39) missense probably damaging 0.99
R5652:Or5k14 UTSW 16 58,692,847 (GRCm39) missense probably damaging 0.99
R5653:Or5k14 UTSW 16 58,692,847 (GRCm39) missense probably damaging 0.99
R8031:Or5k14 UTSW 16 58,693,054 (GRCm39) missense probably benign 0.03
R8108:Or5k14 UTSW 16 58,692,599 (GRCm39) missense probably benign
R8531:Or5k14 UTSW 16 58,693,016 (GRCm39) missense probably damaging 1.00
R8833:Or5k14 UTSW 16 58,692,959 (GRCm39) missense probably damaging 0.99
R9150:Or5k14 UTSW 16 58,693,005 (GRCm39) nonsense probably null
R9318:Or5k14 UTSW 16 58,692,748 (GRCm39) missense probably damaging 1.00
R9389:Or5k14 UTSW 16 58,692,976 (GRCm39) missense probably damaging 1.00
V8831:Or5k14 UTSW 16 58,693,438 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTGAAGGCAGAGCTTCTTGGACATC -3'
(R):5'- GAGGACAACTACTCCTTGGCAACAG -3'

Sequencing Primer
(F):5'- AGCTTCTTGGACATCATGCTG -3'
(R):5'- TGGCAACAGAGTTCATCCTCATAG -3'
Posted On 2014-04-13